We narrowed to 25,303 results for: ung
-
Plasmid#119705PurposePromoter gpdA from Aspergillus nidulans domesticated into pUPD2 with GGAG/AATG barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformation.DepositorInsertPromoter gpdA
UseSynthetic Biology; Domestication of dna parts for…PromotergpdAAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB029
Plasmid#119713PurposePromoter paf from Penicillium chrysogenum domesticated into pUPD2 with GGAG/AATG barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformation.DepositorInsertPromoter paf
UseSynthetic Biology; Domestication of dna parts for…PromoterPromoter pafAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB030
Plasmid#119714PurposeTerminator paf from P. chrysogenum domesticated into pUPD2 with GCTT/CGCT barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformationDepositorInsertTerminator paf
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB005
Plasmid#119678PurposeCoding sequence nptII from E. coli domesticated into pUPD2 with AATG/GCTT barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformationDepositorInsertgeneticin resistance marker
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB001
Plasmid#119057PurposePromoter trpC from Aspergillus nidulans domesticated into pUPD2 with GGAG/AATG barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformation.DepositorInsertPromoter trpC
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB002
Plasmid#119676PurposeTerminator tub from Neurospora crassa domesticated into pUPD2 with GCTT/CGCT barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformationDepositorInsertTerminator tub
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB008
Plasmid#119706PurposeTerminator trpC from Aspergillus nidulans domesticated into pUPD2 with GCTT/CGCT barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformationDepositorInsertTerminator trpC
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB026
Plasmid#119711PurposeTranscriptional Unit (TU) for YFP expression, obtained by combining FB/GBparts FB007+GB0053+FB008 into pDGB3alpha1R. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPromoter gpdA:YFP coding sequence:Terminator trpC
UseSynthetic BiologyAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FB013
Plasmid#119710PurposeTU of the HSVtk negative marker for F2dU domesticated into pUPD2 with GGAG/TACT barcodes (reverse orientation). Used for gene KO with dual selec. According to FungalBraid modular DNA assembly for ATMTDepositorInsertNegative selection marker HSVtk (Pgpda:HSVtk:Ttub)
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
JDS246
Plasmid#43861PurposeExpresses mammalian codon optimized Cas9 nuclease with C-term 3X FLAG from CMV and T7 promotersDepositorInsertmammalian codon-optimized streptococcus pyogenes Cas9 - 3X Flag
UseCRISPRTags3X FLAGExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_Pro_NHis_CAvi
Plasmid#234394PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsMHHHHHHSSGVDLG and SSKGGYGLNDIFEAQKIEWHEExpressionBacterialPromoterT7Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_Hel_NAviCHis
Plasmid#234397PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsMHHHHHHSSGVDLG and SSKGGYGLNDIFEAQKIEWHEExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-hVASA-KO-WPRE
Plasmid#214124PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInserthKO
ExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_FL_NHisTEV_CThromAvi
Plasmid#234385PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CHICKV_KY575571.1_NSP2_Pro_NHisTEV_CThromAvi
Plasmid#234386PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_CHICKV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFGL1009
Plasmid#119080PurposeIntroducing ectopic integration at the defined fungal ILV2-locus, based on SRR (Sulfonylurea Resistance Reconstitution).DepositorTypeEmpty backboneUseFungal expressionAvailable SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmSTARRseq1
Plasmid#96945PurposeCpG free plasmid for testing effects of methylation on regulatory activityDepositorTypeEmpty backboneUseMstarr-seq screening vectorExpressionMammalianPromoterCpG -free EF1 promoterAvailable SinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only