We narrowed to 9,227 results for: sgRNA
-
Plasmid#199485PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2
UseCRISPRAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSA_2_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2
Plasmid#199486PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertGal4vp16/4xnrUAS-mTagBFP2
UseCRISPRAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSA_1_mKate2_synCoTC
Plasmid#199470PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertmKate2
UseCRISPRAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSA_0_mTagBFP2_synCoTC
Plasmid#199472PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertmTagBFP2
UseCRISPRAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSA_1_mTagBFP2_synCoTC
Plasmid#199473PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorInsertmTagBFP2
UseCRISPRAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTJV1Sc2-tetA
Plasmid#166982PurposeGenerates ssDNA in vivo targeting tetA for recombineering w/ CspRecT recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aada for spectinomycin resistanceDepositorInsertCspRecT
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpVanCCAvailable sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6Rosa-CAG-Cas9
Plasmid#118998PurposeMammalian expression of Rosa26 sgRNA, Cas9 and BFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9
ExpressionMammalianPromoterCAGAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330.iGFP5
Plasmid#66584PurposesgRNA for iGFPDepositorPublicationInsertiGFP
ExpressionMammalianAvailable sinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330.iGFP2
Plasmid#66582PurposesgRNA for iGFPDepositorPublicationInsertiGFP
ExpressionMammalianAvailable sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330.Pten.b
Plasmid#66588PurposesgRNA for Pten deletionDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPten deletion (Pten Mouse)
ExpressionMammalianAvailable sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330.LoxPO
Plasmid#66585PurposesgRNA for LSLDepositorPublicationInsertLSL-Tomato
ExpressionMammalianAvailable sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458-3xHA-FnCas9
Plasmid#130969Purpose3xHA tagged Cas9 from F. novicida with T2A-EGFP and cloning backbone for sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFnCas9
UseCRISPRTags3xHA-NLS and NLS-T2A-EGFPExpressionMammalianPromoterCbhAvailable sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hCRISPRi_dual_3_4
Pooled library#187247PurposeUltra-compact, human genome-wide CRISPRi library targeting each gene with a single element encoding a dual sgRNA cassette.DepositorSpeciesSyntheticUseLentiviralAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, Stress and Proteostasis (h3), top 5 sgRNAs/gene
Pooled library#83982PurposeHuman CRISPRa Pooled Library targeting stress and proteostasis genesDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone3
Plasmid#162127PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGE503
Plasmid#153276PurposeIntermediate sgRNA array cloning vector position 1DepositorTypeEmpty backboneUseCRISPRAvailable sinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE508
Plasmid#153280PurposeEnd-linker for cloning 2 sgRNA arrays into any recipient vectorDepositorInsertlinker
UseCRISPRAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only