We narrowed to 26,661 results for: Vit;
-
Plasmid#71755PurposeHis-TEV-Aurein1.2+36GFP-LPETG-His expression in E.ColiDepositorInsertAurein1.2_(pos36_GFP)-LPETG-His
Tags6XHis, Sortase (LPETG), and TEV ProteaseExpressionBacterialAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21b-Caspase-3(D3A,V266E)
Plasmid#90091PurposeExpresses caspase D3A and V266E mutant in bacterial cellsDepositorAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-shN
Plasmid#73665PurposepSIREN-RetroQ vector containing control sequence NDepositorInsertshRNA Neg Control
UseRetroviralAvailable SinceMarch 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBAD-HisD-KRaION2
Plasmid#177800PurposeBacterial expression of green fluorescent potassium indicator KRaION2DepositorInsertKRaION2
ExpressionBacterialPromoteraraBAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-Rheb(5A)
Plasmid#192439PurposeEncodes mCherry-tagged Rheb lacking residues 38-42.DepositorInsertmCherry-Rheb(C181S) (RHEB Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationRheb amino acids 38-42 deleted.PromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-FlicR1
Plasmid#74143PurposeExpress FlicR1 preferentially in neuronsDepositorInsertFlicR1
UseAAVExpressionMammalianPromoterhSynAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
LL - hOCT4i -2
Plasmid#12197DepositorAvailable SinceSept. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
CMV/N3IC-HA
Plasmid#47618Purposein vitro transcription and translation of HA-tagged Notch3 Intracellular domainDepositorInsertNotch3 Intracellular domain (Notch3 Mouse)
UseIn vitro transcription and translationTagsHAExpressionMammalianMutationcodons 1664 (Met) to 2318 (Ala)PromoterCMVAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSlug-4
Plasmid#40648DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLEG(R1-R3) #BGV149
Plasmid#48956PurposeLentiviral Destination vector containing AttR1-AttR3 site. For use with three-way LR reaction with cDNA in entry vector and a marker in pBEG R2-L3 plasmids (module 2 and module 3 plasmids).DepositorTypeEmpty backboneUseLentiviralPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRc/RSV Flag MKK3
Plasmid#14671DepositorAvailable SinceJuly 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
eNme2-C TadDE
Plasmid#193842PurposeExpress TadDE (with eNme2-C variant) in mammalian cellsDepositorInserteNme2-C TadDE
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-lox-CAT-lox-unique Bam cloning site-hGH polyA (Clone 17)
Plasmid#53959Purposeallows Cre-mediated expression of transgeneDepositorTypeEmpty backboneUseCre/LoxTagsLox-CAT-LoxExpressionMammalianPromoterCMV enhancer, chicken actin promoterAvailable SinceJune 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
OmpA-mNG-mCh
Plasmid#124216PurposePeriplasmic OM bound mNeongreen mCherry tandem, ~16 % energy transfer. pNM004 - pTHV037-OmpA-SA1-177-(SA-1)-LEDPPAEL-mNG-mChDepositorInsertOmpA-mNG-mCh
ExpressionBacterialAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMPMA3dPlac-PssaG-GFPLVA
Plasmid#23343DepositorInsertGFP(LVA)
TagsGFP(LVA)ExpressionBacterialAvailable SinceApril 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SENP8 (full length))
Plasmid#16361DepositorInserthuman SENP8 full length (SENP8 Human)
TagsHisExpressionBacterialMutationhuman SENP8 full length, see Depositor CommentsAvailable SinceDec. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBS-KLF7-200-GFPfr1
Plasmid#169799PurposeTHe donor vector for the KLF7 gene locus.DepositorInsertDonor sequence to KLF7 neighbouring region for HR
UseHr donor vector for human actb gene.MutationPartial sequence of GFP is inserted the sequence …Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
attB53-Pac-TRE-mCherry-attB53
Plasmid#183611PurposeRMCE vector to shuttle puromycin resistance and TRE-mCherry cassettes into attP50-flanked landing pad. Designed for use with pmROSA26-attP50-Neo-mKate2-3xNLS-attP50 vector (Addgene 183609).DepositorInsertTRE-mCherry
UseRmcePromoterTREAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only