We narrowed to 27,381 results for: c-myc
-
Plasmid#178652PurposeMammalian expression of myc-tagged MR1 (H83P)DepositorInsertMR1 (MR1 Human)
TagsExtracellular c-myc epitope ta and Signal peptide…ExpressionMammalianMutationH83PPromoterCMVAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4 MR1 (Q153P)
Plasmid#178653PurposeMammalian expression of myc-tagged MR1 (Q153P)DepositorInsertMR1 (MR1 Human)
TagsExtracellular c-myc epitope ta and Signal peptide…ExpressionMammalianMutationQ153PPromoterCMVAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG109 H2B-FAST
Plasmid#130722PurposeExpresses FAST (also called YFAST) fused to zebrafish histone H2B in mammalian cellsDepositorInsertH2B-FAST
Tagsmyc-tagExpressionMammalianPromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-human LRRC33
Plasmid#111602PurposeExpress human LRRC33 in 293T cellsDepositorAvailable sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3 CHICA (Nigg HS342)
Plasmid#41153DepositorInsertCHICA (FAM83D Human)
Tags3xMyc and PreScission SiteExpressionMammalianMutationV11LPromoterCMVAvailable sinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJL388
Plasmid#243717PurposeStably expresses a Myc-tagged AKAP1 with a GDDG mutation and gRNA-resistant silent mutationsDepositorInsertAKAP1 (AKAP1 Human)
UseLentiviralTagsMycMutationGXXG motif (GKQG 624-627) mutated to GDDG, and gR…Available sinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMA3228
Plasmid#46856PurposeA lentiviral vector encoding a fusion between codon-optimized P.aeruginosa exoY mutant (K81M) and myc-tagged destabilized FKBP12DepositorInsertExoY K81M
UseLentiviralTagsFKBP E31G, R71G, K105E and MycPromoterTRE-TightAvailable sinceSept. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-H2B-EGFP-P2A-N2c(G)
Plasmid#73482PurposeCloning vector containing N2c Glycoprotein and histone GFPDepositorInsertH2B-EGFP-P2A-N2c(G)
ExpressionMammalianAvailable sinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGWB21_TaNAM-A1
Plasmid#124572PurposeExpresses full-length TaNAM-A1 with an N-terminal 10x Myc tag under the 35s promoter.DepositorInsertTaNAM-A1
Tags10xMycExpressionPlantPromoter35sAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ERAP1-rs27895(C)
Plasmid#206142PurposeExpresses the rs27895-C allele of ERAP1, myc-tagged.DepositorInsertERAP1 (ERAP1 Human)
Available sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
kVh-LYN
Plasmid#259385PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-EPHB1
Plasmid#259380PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-EPHA4
Plasmid#259386PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-FES
Plasmid#259382PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJD460
Plasmid#246006PurposeA plasmid for Massively Parrallel Reporter Assays of 5'UTR function. It includes a CMV promoter, ITRs for AAV packaging, cloning sites. This does not include elements or reporters.DepositorTypeEmpty backboneUseAAV and Cre/LoxTagsN-terminal Myc Tag on a TdTomato (which has an in…ExpressionMammalianAvailable sinceAug. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJD486
Plasmid#246005PurposeA plasmid for Massively Parallel Reporter Assays of 5'UTR function. It includes a CMV promoter, ITRs for AAV packaging, cloning sites. This is derived from pJD460 (Addgene #246006) by adding reporter.DepositorTypeEmpty backboneUseAAV and Cre/LoxTagsN-terminal Myc Tag on a TdTomato (which has an in…ExpressionMammalianPromotercmvAvailable sinceAug. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-FGFR3
Plasmid#259383PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-igκ-mEGFP-TM
Plasmid#259743PurposeA mammalian expression vector designed to express the mEGFP-tagged SynTrogo ligand in vitro under the control of the CMV promoter.DepositorInsertigk-mEGFP-PDGFR TM (IGK Human, Synthetic)
TagsEGFP, Myc, and PDGFR TMExpressionMammalianPromoterCMVAvailable sinceAug. 5, 2026AvailabilityAcademic Institutions and Nonprofits only