We narrowed to 13,668 results for: ache
-
Plasmid#204565PurposeExpresses GST-Strep-FLAG-tagged UFM1 in E.coliDepositorAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pLN484 (FuGW-S(cMYC)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe)
Plasmid#105192PurposeModule 1 - synthetic promoter cMYC drives self-inhibiting GAD expression (see PMID: 29056342 for detailed information)DepositorInsertS(cMYC)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-ILKAP
Plasmid#34817DepositorInsertintegrin-linked kinase-associated serine/threonine phosphatase 2C (ILKAP Human)
TagsHis and TEVExpressionBacterialAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_RAF1_94
Plasmid#111826PurposeKnockout Raf1DepositorInsertgRNA targeting RAF1 94-114 (RAF1 Human)
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
B*07:05:01
Plasmid#203268PurposeOverexpress HLA alleleDepositorInsertB*07:05:01 (HLA-B Human)
ExpressionMammalianAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Blunt-U6-HES7-STOP-gRNA
Plasmid#130933PurposegRNA for tag human HES7DepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
SIN-CMV-Cas9-V5-WPRE
Plasmid#87904PurposeTo produce lentiviral vector for gene editingDepositorInsertCas9-V5
UseLentiviralTagsV5Mutationhuman codon-optimizedPromoterCMVAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHEN-CoV2-nanobody-Ty1
Plasmid#194588PurposeBacterial expression of Ty1 nanobody targeting the receptor binding domain (RBD) of SARS-CoV-2 spikeDepositorInsertTy1 (S )
ExpressionBacterialAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-FLAG
Plasmid#105783PurposeExpression of your protein of interest in fusion with FLAG at the C-terminus. The tag is cleavable by TEV protease.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-FLAGExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp8
Plasmid#157695Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp8 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
DNMT1 KO Neo
Plasmid#16649DepositorInsertDNMT1 knock-out construct (DNMT1 Human)
ExpressionBacterialAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-H1-sgHtt1-7SK-sgCas9-PGK-mCherry-WPRE
Plasmid#87912PurposeKamicas9 lentiviral vectorDepositorInsertshHTT1, sgCas9, cherry
UseLentiviralPromoterH1, 7SK, PGKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 L22R
Plasmid#11021DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-pH-Flag-Cter (VE5739)
Plasmid#161799PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the pH promoter.DepositorInsertC-terminal Flag tag
TagsFlagExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-HA-Nter-P10-mCherry (VE5740)
Plasmid#161800PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a N-ter HA tag under the pH promoter.DepositorInsertN-terminal HA tag
TagsHAExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-Flag-Nter (VE5627)
Plasmid#139773PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an N-ter Flag tag under the pH promoter.DepositorInsertN-terminal Flag tag
TagsFlagPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-HA-Cter (VE5629)
Plasmid#139775PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter HA tag under the pH promoter.DepositorInsertC-terminal Hemaglutinine tag
TagsHAPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-6His-Cter (VE5630)
Plasmid#139777PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter6His tag under the pH promoter.DepositorInsertC-terminal 6His tag
Tags6 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only