We narrowed to 13,244 results for: BASE;
-
Plasmid#176680PurposeExpression of Drosophila codon optimized spCas9 under Ae. aegypti Polyubiquitin promoter (AAEL003888)DepositorInsertspCas9; NeoR (aminoglycoside phosphotransferase from Tn5)
UseCrisprExpressionInsectMutationDrosophila codon optimizedPromoterAe. aegypti poly-ubiquitin (AAEL003888)Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNX10-PX (1-201)
Plasmid#119091PurposeBacterial expression of human phox homology (PX) domain, SNX10-PX (1-201)DepositorAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD406
Plasmid#163111PurposeExpression of mNeonGreen_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mNeonGreen_H-NSdbd_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRD399
Plasmid#163106PurposeExpression of mEGFP_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mEGFP_H-NSdbd_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti PA-mCit
Plasmid#113451PurposeLentiviral ProteinA-mCitrine expression vectorDepositorInsertProteinA-mCitrine
UseLentiviralExpressionMammalianPromoterhUBbCAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGLOW77
Plasmid#177338PurposeC. elegans mNeonGreen co-injection markerDepositorInsertPmyo-2::mNeonGreen
TagsmNeonGreenExpressionWormPromotermyo-2Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLOW31
Plasmid#172698PurposeC. elegans mScarlet co-injection markerDepositorInsertPmyo-3::mScarlet
TagsmScarletExpressionWormPromotermyo-3Available SinceAug. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR(Y107A)-Hygro
Plasmid#176073PurposeEGFP fused to the C-terminus of a WWE domain containing the mutation Tyr107Ala & a hygromycin resistance cassetteDepositorInsertLivePAR (Y107A)
UseLentiviralTagsEGFPExpressionMammalianMutationPoint mutation to convert Try107 to AlaPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
HT109_pAAV_hSyn-DiO-SomQuasAr6a_EGFP
Plasmid#190878PurposeCre-on expression of soma-targeted QuasAr6a under an neuronal promoterDepositorInsertsomQuasAr6a_EGFP
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-3xnls-Tq-Ca-FLITS
Plasmid#145030PurposepiggyBac vector for expressing a Turquoise calcium sensor (GECI) that reports with lifetime and intensity changesDepositorInsert3xnls-Tq-Ca-FLITS
Tags3xnls-Tq-Ca-FLITSExpressionMammalianPromoterCMVAvailable SinceJune 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWPSG-Ptet-nCas9-BE
Plasmid#195739PurposeExpress APOVEC1-nCas9(D10A)-UGI using aTC inducible system in Methanotroph or E. coliDepositorArticleInsertTet repressor protein / APOBEC1-nCas9(D10A)-UGI
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPtet(Tetracycline inducible protein)Available SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MYH11-gRNA1
Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
ExpressionBacterialAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Httex1-43Q
Plasmid#84352PurposeExpression of the human Huntingtin Exon1 protein containing 43Q in E.coliDepositorInsertHuntingtin Exon 1 (HTT Human)
TagsN-terminal Ssp intein (His-tagged)ExpressionBacterialPromoterT7Available SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-LivePARBackbone
Plasmid#176526PurposeExpression vector with a BamHI site in-frame with a Gly-Ser linker fused to EGFP; serves as the backbone for PAR binding domain incorporation for LivePARDepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-GST-4
Plasmid#228986PurposeFor bacterial expression of anti-GST nanobody GST-4, with pelB leader for periplasmic secretion, and C-term 6xHIS tag.DepositorInsertGST-4
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only