We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#188713PurposesgRNA plasmid encoding mU6 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
p7SK ST
Plasmid#188714PurposesgRNA plasmid encoding 7SK promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 ST
Plasmid#188715PurposesgRNA plasmid encoding hH1 promoter driving an anti-safe targeting sgRNADepositorInsertSafe Targeting sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcnab2
Plasmid#192795PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcnab2DepositorInsertsgKcnab2
UseAAV and CRISPRPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY108
Plasmid#130938PurposeEngineered sgRNA-LEB1 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEB1
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
AP625-1
Plasmid#70051PurposeExpresses myc::TEV::3Xflag::eGFP::3Xflag::TEV::myc in bacteriaDepositorInserteGFP
Tags3Xflag::TEV::myc and myc::TEV::3XflagExpressionBacterialAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLY103
Plasmid#130937PurposeEngineered sgRNA-LEA1 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA1
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAP608-1
Plasmid#99484PurposeH2B::linker::GFP (contain 3 introns)::3XFlag::TEV::Myc::tbb-2 3UTRDepositorInsertH2B::linker::GFP with introns::3XFlag::TEV::Myc::tbb-2 3UTR
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDD401
Plasmid#91828PurposePmyo-2::GFP FP-slot donor for the SapTrap cloning systemDepositorInsertPmyo-2::GFP
UseCRISPRExpressionWormMutationNucleotide 489 of the myo-2 promoter was changed …Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-TREX2-N
Plasmid#244025PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-TREX2-N
Plasmid#244022PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-AtEXO1B-N
Plasmid#244023PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-AtEXO1B-N
Plasmid#244024PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
Plasmid#231400PurposeKnockdown of DRD1 across rodent speciesDepositorInsertsgRNA(DRD1.2)
UseAAV and CRISPRExpressionMammalianPromoteru6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD2)-hSyn-mCherry
Plasmid#231401PurposeKnockdown of DRD2 across rodent speciesDepositorInsertsgRNA(DRD2.1)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(CTRL)-hSyn-mCherry
Plasmid#231405PurposeCTRL knockdown gRNADepositorInsertsgRNA(CTRL)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonorTp-fugfp
Plasmid#211790PurposepDonorTp with addition of fugfp gene from pUS252 outside of the FRT sitesDepositorInsertfuGFP
Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only