We narrowed to 27,842 results for: gfp
-
Plasmid#196629PurposeExpress GFP-RELADepositorAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable sinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDZ274 (pLEU MET25pro MCP-2x-yeGFP)
Plasmid#45929DepositorInsertMCP-2x-yeGFP
Tags2x-yeGFPExpressionYeastPromoterMET25Available sinceAug. 8, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSCV-CMV-DsRed-IRES-d1EGFP
Plasmid#41942PurposeRetroviral expression of DsRed in mammalian cellsDepositorInsertDsRed
UseRetroviralExpressionMammalianPromoterTREAvailable sinceMay 2, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDual-eGFP(H66)
Plasmid#63558PurposeExpression of the Azure (blue) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(H66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
TetOn-REEP5-mCherry-eGFP
Plasmid#139870PurposeDox-inducible lentiviral expression of human REEP5DepositorAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBI-MCS-EYFP
Plasmid#58855PurposeThe tet-responsive reporter pBI-MCS-EGFP (Addgene plasmid 16542) was modified to express YFP instead of GFPDepositorPublicationInsertenhanced yellow fluorescent protein
ExpressionMammalianPromoterCMVAvailable sinceOct. 27, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAGH42
Plasmid#107249PurposeVipp1-mGFPmut3 (or vipp1-gfp) construct with spectinomycin resistance cassette downstream used to replace the native copy of Vipp1 in Synechocystis (sll0617).DepositorInsertvipp1-gfp
UseSuicide vector for destined for double homologous…TagsmGFPmut3ExpressionBacterialPromoternative promoter of sll0617Available sinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pENN.AAV.CB7.CI.eGFP.WPRE.rBG (AAV1)
Viral prep#105542-AAV1PurposeReady-to-use AAV1 particles produced from pENN.AAV.CB7.CI.eGFP.WPRE.rBG (#105542). In addition to the viral particles, you will also receive purified pENN.AAV.CB7.CI.eGFP.WPRE.rBG plasmid DNA. CB7-driven eGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCB7TagsEGFPAvailable sinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1aL-WT_ABCA3-GFP
Plasmid#188548PurposeLentiviral vector allowing for EF1aL-driven constitutive expression of wildtype human ABCA3:GFP fusion proteinDepositorAvailable sinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-mEGFP-CHMP2A
Plasmid#115328Purposeexpresses mEGFP-CHMP2A in mammalian cellsDepositorAvailable sinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-64: FUS-mEGFP
Plasmid#114410PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human FUSDepositorInsertFUS Homology Arms with linker-mEGFP (FUS Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available sinceSept. 5, 2018AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
p3xP3-EGFP.vas-int.NLS
Plasmid#60948PurposeDrosophila, p3xP3-EGFP.vas-int.NLS.attB was digested SpeI to get rid of the attB site. used for RMCE. CRISPR.DepositorInsertvas-phiC31 integrase.NLS
UseRmcePromotervasaAvailable sinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRL056 pDESTattB_exorh:EGFP
Plasmid#213510PurposeattB-containing pDEST plasmid, for use in Multisite Gateway reactionDepositorTypeEmpty backboneUseZebrafish expressionAvailable sinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1-YAPS127A
Plasmid#166458PurposeExpresses fusion of mEGFP and YAPS127ADepositorInsertmEGFP, YAPS127A (YAP1 Human)
ExpressionMammalianAvailable sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable sinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-hsGFP
Plasmid#64912PurposeEncodes a Fluorescent Reporter for Hydrogen Sulfide in Mammalian CellsDepositorInserthsGFP
Tags6xHisExpressionMammalianMutationChromophore tyrosine of the protein mutated to TA…PromoterCMVAvailable sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only