We narrowed to 8,424 results for: 221
-
Plasmid#73531PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2441 - [1-2] ENTR - Fluor - ce-Dendra2(PATCs(900bp), NLS, no_atg, no stop)
Plasmid#159870PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-Dendra2(PATCs(900bp), NLS, no_atg, no stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago2_4
Plasmid#73532PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pLV Reep4-V5
Plasmid#175120PurposeLentiviral expression of mouse Reep4-V5DepositorAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2443 - [1-2] ENTR - Fluor - ce-mMaple3(PATCs(900bp), NLS, no_atg, no stop)
Plasmid#159867PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mMaple3(PATCs(900bp), NLS, no_atg, no stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_MED13_iso1
Plasmid#135733PurposeDonor vector for 3' FLAG tag of human MED13_iso1DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2309 - [1-2] ENTR - Fluor - mCardinal(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
Plasmid#159861PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mCardinal(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRB113.2
Plasmid#181948PurposeaTc-inducible expression of NarL with C-terminal mNeonGreen fusion. Also contains mCherry under NarL-controlled promoter PdcuSDepositorInsertTagsmNeonGreenExpressionBacterialPromoterNarL-mNG-PLtetO-1; mCherry-PdcuS; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_DUM1H01
Plasmid#71090PurposeGateway entry cloneDepositorInsertnej (nej Fly)
UseGateway entry vectorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pLV V5-nurim
Plasmid#175110PurposeLentiviral expression of V5-tagged mouse NrmDepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dicer_3
Plasmid#68809Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.DepositorInsertsgRNA mouse Dicer1
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1820
Plasmid#154321PurposeMulti-cassette for SapTrapDepositorInsertGFP^SEC (LoxP)^AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only