We narrowed to 22,832 results for: Ide
-
Plasmid#59390PurposeDestination vector with RBPMS2 for stable cell line generationDepositorAvailable SinceFeb. 10, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pMB38-HF380
Plasmid#37332DepositorInsertCytoplasmic Dynein Heavy Chain (dhcA Dictyostelium discoideum)
UseDictyostelium expressionTagsHis6 and FLAG tagMutationdeleted amino acids 1-1387PromoterTRE-PminAvailable SinceAug. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1383
Plasmid#29183PurposeExpression of the eGFP reporter gene was not detected in the brain using eGFP. Untested in the eye.DepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pXD69m1-TetW
Plasmid#191246PurposeE. coli - Eggerthella lenta shuttle plasmid with tetracycline resistance in E. lentaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBLO5.01
Plasmid#121418PurposepUC19_BsaI-dCas9-BsaIDepositorInsertdcas9
ExpressionBacterialPromoterlacAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMK1224
Plasmid#84221PurposeLentiviral expression of shRNAs, compatible with double-shRNA expression, SFFV promoter, BFPDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
CBEd SpG UGI Puro
Plasmid#235045PurposeCytosine base editor d with SpG nicking Cas9 makes C > T editsDepositorInsertCBEd, nCas9
UseCRISPR and LentiviralTagsP2A-PuroRPromoterEF1a coreAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (GAPDH)
Plasmid#170120PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH41 [punc-17::YFP-BeCyclOp(A-2x)::SL2::mCherry]
Plasmid#168170PurposeExpression of YFP-BeCyclOp(A-2x) in cholinergic motor neurons of C. elegansDepositorInsertYFP-BeCyclOp(A-2x) (codon optimized for C. elegans)
TagsYFPExpressionWormMutationE497K and C566DAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmNot3
Plasmid#79250PurposeExpresses EGFP-tagged DmNot3 in S2 cellsDepositorAvailable SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRK5_EGFP-control
Plasmid#238257PurposeFor overexpression of EGFP-controlDepositorInsertEGFP
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBad33_ISDge10_reRNA
Plasmid#205340PurposeBacterial expression of ISDge10 TnpB and its reRNADepositorInsertISDge10 TnpB
ExpressionBacterialAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBad33_ISTfu1_reRNA
Plasmid#205355PurposeBacterial expression of ISTfu1 TnpB and its reRNADepositorInsertISTfu1 TnpB
ExpressionBacterialAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD69m2-AphA
Plasmid#191247PurposeE. coli - Eggerthella lenta shuttle plasmid with kanamycin resistance in E. lentaDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-GFP
Plasmid#162033PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsGFPAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNSA-FLUC
Plasmid#98143PurposeGateway compatible construct for N' terminal fusion or promoter driven firefly luciferase reporter, zeocin resistance cassetteDepositorTypeEmpty backboneUseAlgae, nannochloropsisTagsHAAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUSE-B_P2rP4
Plasmid#97185PurposeFor fusion gene cloning. Recombine Gene B into this Gateway Entry VectorDepositorTypeEmpty backboneUseGateway CloningAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001144778)
Plasmid#76393Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Antibody#184203-rAbPurposeAnti-HCN3 (Mouse) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityMouse and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceJune 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits