We narrowed to 14,052 results for: crispr grnas
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 T2 CRIPR in pX330
Plasmid#72833PurposeCRISPR/Cas to target the AAVS1 locus in human cellsDepositorInsertCas9 and gRNA for targeting the AAVS1 locus in human cells
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pM355
Plasmid#173175Purpose(Empty Backbone) Expresses gRNA-12xMBS from hU6 promoterDepositorInsertgRNA-12xMBS backbone
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE27
Plasmid#174405PurposeC. auris LEUpOUT NAT marker gRNA expression construct. Use with pCE35 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE41
Plasmid#174433PurposeC. auris LEUpOUT HYG marker gRNA expression construct. Use with pCE38 CAS9 expression construct.DepositorInsertHYG 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterial and YeastAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM370
Plasmid#173178Purpose(Empty Backbone) gRNA-12xMBSDepositorInsertgRNA-12xMBS
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6T7
Plasmid#71462PurposeExpresses gRNA from hybrid human U6/T7 promoter for both cellular expression and in vitro transcription from same promoter (2 Gs at initiation)DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and MammalianPromoterhuman U6/phage T7Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas34
Plasmid#82386PurposesgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6T7G
Plasmid#71463PurposeExpresses gRNA from hybrid human U6/T7 promoter for both cellular expression and in vitro transcription from same promoter (1 G at initiation)DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and MammalianPromoterhuman U6/phage T7Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas59
Plasmid#82396PurposesgRNA targeting YFP +787 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas45
Plasmid#82390PurposesgRNA targeting YFP with additional bases 5' end like pCas34, but from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas57
Plasmid#82395PurposesgRNA targeting YFP +111 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas52
Plasmid#82392PurposesgRNA targeting YFP +52 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas39
Plasmid#82389PurposesgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas36
Plasmid#82388PurposesgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas35
Plasmid#82387PurposesgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas15
Plasmid#82383PurposesgRNA targeting YFP (truncated to 18 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas14
Plasmid#82382PurposesgRNA targeting YFP (truncated to 15 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas13
Plasmid#82381PurposesgRNA targeting YFP (truncated to 12 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only