167,785 results
-
Plasmid#226857PurposeExpresses ABE8.20-NG base editor in mammalian cells with eGFP markerDepositorInsertABE8.20-NG
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRE reporter backbone
Plasmid#158678PurposeThis plasmid serves as the backbone for the TRE reporters described in our paper. It's a promoterless-mStrawberry-pGK-BSD backbone to which we insert a pathway specific promoter before the mStrawberryDepositorTypeEmpty backboneUseLentiviralTagsmStrawberryExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOS008: GCaMP6F calcium sensor (cytosolic)
Plasmid#163045PurposeGCaMP6F calcium sensor (cytosolic)DepositorInsertGCaMP6F
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1a.WPRE.SV40
Plasmid#100854PurposeAAV expression of jRGECO1a, a red fluorescent calcium sensor protein, from the Synapsin promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, and AAV9InsertjRGECO1a
UseAAVExpressionMammalianPromoterSynapsinAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBBR1k-J23107-GFPuv
Plasmid#106389PurposepBBR1k-GFPuv with Anderson promoter J23107 expressing lacIDepositorInsertGFPuv
ExpressionBacterialPromotertrcAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG BacMam N term His8 eGFP 3C
Plasmid#160684PurposeVector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target proteinDepositorTypeEmpty backboneTagsHis8 eGFP 3CExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-mEGFP(A206K)-paCaMKII(K42M)
Plasmid#165440PurposeExpresses photoactivatable CaMKII(K42M: Kinase dead) in mammalian cells as a negative control.DepositorInsertmEGFP(A206K)-paCaMKII(K42M)
TagsmEGFP(A206K)ExpressionMammalianMutationK42M: Kinase dead mutationPromoterCMVAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
NPC1 His6 EGFP
Plasmid#53521DepositorInsertNPC1
TagsEGFP and His6ExpressionMammalianPromoterCMVAvailable SinceJuly 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_5-HT1.0 (AAV9)
Viral Prep#140552-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_5-HT1.0 (#140552). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_5-HT1.0 plasmid DNA. Synapsin-driven expression of GRAB_5-HT1.0 sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 neo
Plasmid#104996PurposeThis lentiviral construct delivers hSpCas9 and G418 resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET15b-RvLEAMshort
Plasmid#218122PurposeExpresses truncated RvLEAM protein under IPTG induction in bacterial host cells.DepositorInsertRvLEAMshort
Tags6xHISExpressionBacterialMutationTruncated form (58-181aa)PromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCE048-SiT-Cas12a
Plasmid#128124PurposeExpress both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJR89
Plasmid#140096PurposesgRNA constant region and hU6 insert for programmed dual sgRNA cloning. The sgRNA constant region contains a capture sequence (cs1) in the stem loop for direct capture Perturb-seq.DepositorInsertsgRNA constant region CR3 with cs1 in stem loop and hU6 promoter
Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1-mitoRexYFP
Plasmid#60246PurposeMitochondria-targeted genetically encoded fluorescent indicator for measuring NAD/NADH ratio.DepositorInsertmitoRexYFP
TagsMitochondrial targeting signalExpressionMammalianPromoterCMVAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTW335c3
Plasmid#237322Purposeexpresses A. thaliana RbcL RbcS-6xHisDepositorInsertsTags6xHis and NoneExpressionBacterialAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE (AAV1)
Viral Prep#162381-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE (#162381). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8m-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only