We narrowed to 13,668 results for: ache
-
Plasmid#154448PurposeFor recombination of HDLBPDepositorInsertHDLBP (HDLBP Human)
ExpressionMammalianAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET41b+_Ufd1-His
Plasmid#117107PurposeProduction of recombinant Ufd1-His in E.coliDepositorAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTP434
Plasmid#104167PurposeBacterial expression plasmid of anti-GFP nanobody with 3x Cysteines for maleimide labelingDepositorInsertAnti-GFP nanobody Enhancer PDB 3K1K (3x Cysteine)
Tags14x Histidine tag and NEDD8 from Brachypodium dis…ExpressionBacterialMutation3x Cysteines located at bps 493-495, 520-522, and…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSP90(G97D)-mOFP
Plasmid#228195Purposeexpressed human Hsp90 (G97D mutation) with a mOFP fluorescent protein tagDepositorInsertHSP90AA1(G97D) (HSP90AA1 Human)
TagsmOFPExpressionMammalianMutationG97D mutationPromoterCMVAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-BAFFR-CFP
Plasmid#187002PurposeExpression of human BAFFR-CFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1_RAF1 (51-131)
Plasmid#119218Purposepurification of GST-RAF1 RBD from E. coliDepositorInsertRAF1 aa 51-131 (RAF1 Human)
ExpressionBacterialAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
shTCF7L2 # 1
Plasmid#42557DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBX_Sec61b_smGFP_Myc
Plasmid#236092PurposeConstitutively encodes Sec61b-smGFP-Myc (sfGFP-based spaghetti monster fluorescent protein embedding Myc epitope tags), for targeting the endoplasmic reticulum.DepositorInsertSec61b-smGFP-Myc (SEC61B Synthetic, Human)
ExpressionMammalianAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SopB
Plasmid#183657PurposeN-terminally tagged Salmonella Typhimurium SopB for mammalian expressionDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2-WPRE
Plasmid#218871PurposeAAV-mediated expression of improved GABA sensor (positive change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2
UseAAVExpressionMammalianMutationS99A F102Y F104Y L178SPromoterGFAPAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
wt MPC1-FLAG
Plasmid#228903PurposeExpression of wild-type mouse MPC1 protein with a C terminal FLAG tagDepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin beta5-2XEGFP
Plasmid#139779PurposeDetecting Integrin beta5 by fluorescence microscopyDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTarget
Plasmid#214052PurposeExpresses target sequence for Haliangium type III CRISPR-Cas complex; identical to pNon-target (Addgene plasmid # 214053) but contains a protospacer.DepositorInsertTarget sequence
UseTarget rna plasmidExpressionBacterialPromotertrc promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHochTypeIII
Plasmid#214039PurposeBacterial expression plasmid for Haliangium ochraceum type III CRISPR-Cas complex; contains csb2, a minimal CRISPR array with a pTarget spacer, cmr1-6DepositorInsertCas10
UseCRISPRMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-importinα
Plasmid#119679PurposeExpresses DsRed-tagged human importinα in mammalian cellsDepositorInsertimportinα (KPNA2 Human)
TagsDsRedExpressionMammalianMutationContains amino acids 251-529PromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-Tq2CFP-OcsT
Plasmid#71268PurposeEntry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTq2CFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only