We narrowed to 13,668 results for: ache
-
Plasmid#162094PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-FLAG-AU1
UseLentiviralTagsStrepTagII-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-FLAG
Plasmid#162081PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-FLAG
UseLentiviralTagsVSVg-StrepTagII-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp13_GC3opt
Plasmid#157714Purposemammalian expression of untagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorInsertNsp13-HF_GC3opt (ORF1ab SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
ID1-pLVXT
Plasmid#119280PurposeDoxycycline-inducible mouse ID1 from 806 cellsDepositorAvailable SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-mEGFP-WIPI2d (R108E/R125E)
Plasmid#223770PurposeStable expression and inducible recruitment of protein in mammalian cell cultureDepositorAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRI004-pYFAC-riboB-PgpdA-dLbCas12a-VPR-TtrpC
Plasmid#140197PurposeEpisomal expression of dLbCas12a-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivatedPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
NES-EGFP-cPHx2
Plasmid#116854PurposePI(3,4)P2 biosensorDepositorInsertPLEKHA1 (PLEKHA1 Human)
TagsEGFP and X.leavis map2k1.L(32-44)ExpressionMammalianMutationamino acids 169-329 (tandem dimer)Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-CMV-mTagBFP2-2A-FLAG-ntcGAS
Plasmid#102603PurposeLentivector to express Flag-tagged and shRNA-resistant cGAS and mTagBFPDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMVA2
Plasmid#119951PurposeExpresses recombinant MVA pathway in Escherichia coliDepositorInsertsmvaE
mvaS
mvaK1
mvaK2
mvaD
idi
ExpressionBacterialMutationA110GAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ASC-CASP1 Octamer
Plasmid#164032PurposeBacterial expression vector encoding a 5GSS-linked ASC(CARD)-CASP1(CARD) construct to express an octamerDepositorTagsHis6-MBP-TEVExpressionBacterialMutationW169G (ASC), G20K (CASP1)Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3xVenusYFP-OcsT
Plasmid#71271PurposeEntry clone containing three repeats of Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsert3 times VenusYFP
UseGatewayTagsoctaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-StrepTagII-FLAG
Plasmid#162101PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-StrepTagII-FLAG
UseLentiviralTagsVSVg-StrepTagII-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-VSVg-ProtC-AU1
Plasmid#162105PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to VSVg-ProtC-AU1
UseLentiviralTagsVSVg-ProtC-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-StrepTagII-FLAG-AU1
Plasmid#162114PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to StrepTagII-FLAG-AU1
UseLentiviralTagsStrepTagII-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3mC_Puro-T2A-mCherry-ProtC-HA-FLAG
Plasmid#162115PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to ProtC-HA-FLAG
UseLentiviralTagsProtC-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-HA-FLAG
Plasmid#162086PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-HA-FLAG
UseLentiviralTagsVSVg-HA-FLAGMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-StrepTagII-HA-AU1
Plasmid#162093PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-HA-AU1
UseLentiviralTagsStrepTagII-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-ProtC-HA-AU1
Plasmid#162096PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to ProtC-HA-AU1
UseLentiviralTagsProtC-HA-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only