We narrowed to 26,235 results for: p
-
Plasmid#237483PurposeExpress NUP98::NSD1 in bicistronic retroviral vectorDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CAG-flex-iGluSnFR4f-PDGFR-WPRE
Plasmid#234448PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterGFAPAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rMERTK-HITI
Plasmid#87119PurposeGene correction donor AAV for RCS rat. AAV backbone plasmid including exon 2 of rat Mertk and rMertkgRNA for HITIDepositorInsertU6-rMertksgRNA-Mertk(intron1-2)-nEF-GFPKASH-pA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAH34 (Phsp-16.41::cGAL-N::let-858 3'UTR)
Plasmid#107133PurposecGAL-N driver under the control of C. elegans hsp-16.41 promoterDepositorInsertNLS::cGAL(DBD)::gp41-1-N-intein
ExpressionWormPromoterC. elegans hsp-16.41 promoterAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha into TRAC HDRT Source (pTR 223)
Plasmid#112023PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alphaDepositorInsertNYESO alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCWX-R4-DEST-R2-PG
Plasmid#45957DepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO_EGFP-GFE3 (AAV1)
Viral Prep#79871-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Ef1a-DIO_EGFP-GFE3 (#79871). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO_EGFP-GFE3 plasmid DNA. EF1a-driven, Cre-dependent expression of GFP-GFE3. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
SIV_Gag_Pol
Plasmid#236243Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV Gag and PolDepositorInsertSIV Gag and Pol
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-ERalpha
Plasmid#215093PurposeExpresses HA-ERalpha in mammalian cells.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Cyclin B1
Plasmid#215049PurposeExpresses EGFP-Cyclin B1 in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG_Xph20-GCaMP7f-CCR5TC
Plasmid#216534PurposeEncodes a specific PSD-95 binder (Xph20) fused to GCaMP7f, CCR5TC zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph20
TagsGCaMP7fExpressionMammalianPromoterCAGAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
hKCNQ3(WT).ires.mCherry-pcDNA3
Plasmid#204362PurposeHeterologous expression in mammalian cell lines or Xenopus oocyte (T7 RNA pol)DepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
RFP-PASS
Plasmid#193971PurposeMonitoring the production of phosphatidic acid with RFP-PASS (phosphatidic acid biosensor with superior sensitivity)DepositorInsertPA biosenor
ExpressionMammalianPromoterCMVAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMax_mOrange_A215C
Plasmid#177828PurposeSite-specific mutagenesis of mOrange for the purposes of creating a site-specific 8-oxo-G:C lesion for the purposes of measuring OGG1 activity via Host Cell Reactivation (HCR).DepositorInsertmOrange_A215C
ExpressionMammalianMutationA215CPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only