We narrowed to 18,351 results for: multi
-
Plasmid#207838PurposeInducible TRIM21 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsTagsweak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pTRE-BI-osTIR1
Plasmid#207840PurposeInducible TIR1 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsosTIR
mCherry
mAID_-VHH-GFP4
Tags3X HA-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-CRY2-mCh-superPLDx100-P2A-CIBN-CAAX
Plasmid#188994PurposeA plasmid for dual expression of CRY2-mCh-superPLDx100 (an engineered PLD mutant with 100 times higher activity than the wild-type) and plasma membrane-tagged CIBNDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPLD
TagsCAAX, CIBN, CRY2, P2A, and mCherryExpressionMammalianMutationK57R, A59V, K109R, P245A, V264I, G328S, G381V, G4…PromoterCMVAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-GFP-shRNA-GluN1
Plasmid#182502PurposeExpresses shRNA against mouse NMDA receptor NR1 subunit. Flexed cassette driven by hdc (pan neuronal) gene promoterDepositorInsertpan neuronal promoter (hdc basal promoter) driving flexed-GFP-mir30-shRNA NR1 cassette
UseAAV, Cre/Lox, and RNAiExpressionMammalianPromoterfragment of histidine decarboxylase gene promoter…Available sinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
AttB_ACE2[dEcto]_IRES-mCherry-H2A-P2A-PuroR
Plasmid#171596PurposeEctodomain deleted negative control ACE2 from Bxb1 landing padDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsUseSynthetic Biology; Promoterless bxb1 dna recombin…ExpressionMammalianAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCyCEN_Lisp2mCherry_hsp70_GFP
Plasmid#137169PurposeDual fluorescent reporter for liver stage expression in Plasmodium cynomolgiDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsmCherry
Nanoluc
dihydrofolate reductase
Green Fluorescent Protein
UseUnspecifiedTagsT2APromoterP. cynomolgi hsp70 and P. cynomolgi lisp2Available sinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6_sgRNA_CAG_ABE7.10_St1Cas9_LMD9
Plasmid#136660PurposeExpresses ABE St1Cas9 LMD9 in mammalian cells along with its U6-driven sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
ABE7.10
UseCRISPR and Synthetic BiologyTagsSV40 NLS and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-flex-ChR2 (E123T/T159C)-EYFP
Plasmid#135176PurposeAAV expression of TRE(TRE3G)-driven, Cre-dependent, humanized channelrhodopsin E123T/T159C mutant fused to EYFP for optogenetic activation.DepositorInsertshChR2
TRE3G
UseAAV and Cre/LoxTagsEYFP (C terminal on insert)ExpressionMammalianMutationE123T and T159CPromoterTRE3GAvailable sinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFGL1252_TetOFF(Hyg)
Plasmid#118992PurposeTetOFF (promoter-less) cassette with Hygromycin selectionDepositorInsertstTA+Tnos
Hygromycin cassette
Ttub+PtetO
UseFungal expression (in magnaporthe oryzae)MutationCodon optimized for Magnaporthe oryzaePromoterAspergillus nidulans TrpC promoter, Ustilago mayd…Available sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL
Plasmid#119952PurposeExpresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.DepositorInsertsgpps
limS
ExpressionBacterialMutationN-terminal truncation of 56 amino acid residues (…Available sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav3.1 Ca2+ channel [N178A/9.1R]
Plasmid#114520PurposeMammalian Expression Plasmid of anti-Cav3.1 Ca2+ channel (Mouse). Derived from hybridoma N178A/9.1.DepositorInsertanti-Cav3.1 Ca2+ channel (Mus musculus) recombinant mouse monoclonal antibody (Cacna1g Mouse)
ExpressionMammalianPromoterdual CMVAvailable sinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP323-pAAV-FullH1TO-SaCa9gRNAi(SapI)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113700PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in a gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
Plasmid#111393PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianPromoterhSynapsinAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CMV-CAD
Plasmid#73567PurposeSoluble activator of Orai1 channelsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCAD (STIM1 342-448) (STIM1 Human)
ExpressionMammalianPromoterCMV Immediate EarlyAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-gusA
Plasmid#67036PurposePlasmid for Paph-gusA integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
gusA
UseConjugative bacterial vectorAvailable sinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimer
Plasmid#66779PurposeThe rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signalingDepositorInsertshbeRhGC
red fluorescent protein
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable sinceOct. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
p168-759
Plasmid#62619PurposeePathBrick pETM6 vector encoding CsF3H, AaDFR, DuLAR with Protein Scaffold GBD:SH3:PDZ (1:1:4)DepositorInsertsflavaone 3B-hydroxylase
dihydroflavonol 4-reductase
leucoanthocyanidin reductase
Scaffold Protein encoding GBD:SH3:PDZ (1:1:4)
UseSynthetic BiologyTagsGBD, PDZ, and SH3ExpressionBacterialPromoterT7Available sinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-4A
Plasmid#51247PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907 mutated to AlaPromoterEF1aAvailable sinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
hCMV-IE1:GLuc:bgH
Plasmid#135294PurposeTranscriptional unit for constitutive expression of GLuc in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCMV:GLuc:bGH
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only