We narrowed to 15,169 results for: GRN
-
Plasmid#36348DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pAAV.U6.shRNA-Sdc1-1376
Plasmid#195574PurposeExpresses shRNA to knockdown mouse Syndecan-1DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Bmi1_3
Plasmid#36354DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-G9A_2
Plasmid#36332DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-scramble
Plasmid#118349PurposeThis plasmid expresses scrabled shRNA for use as a control for shRNA HSFs plasmids.DepositorInsertscrambled shRNA
ExpressionMammalianMutationWTAvailable SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-mPRAS40
Plasmid#15480DepositorAvailable SinceAug. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75240PurposeCRISPR/Cas9 plasmid against human IkarosDepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75241PurposeCRISPR/Cas9 plasmid against human IkarosDepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Mmu
Plasmid#127698PurposeDoxycyclin inducible shRNA knockdown of mouse cGAS geneDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-4
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-MGAT1-KO
Plasmid#80009PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.DepositorInsertMGAT1 (MGAT1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin2b
Plasmid#124851PurposeMutagenesis of Grin2bDepositorInsertGrin2b (Grin2b Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-SpCas9-BlastR
Plasmid#107190PurposeConfers constitutive expression of SpCas9DepositorInsertSpCas9 (NEWENTRY )
UseCRISPRTags3xFLAGExpressionBacterial and MammalianPromoterChicken ß-actinAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 RagB shRNA #2
Plasmid#26628DepositorAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-GFP (PX458)
Plasmid#129026Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
plko.1/shMCT4 #474
Plasmid#99597PurposeKnockdown of MCT4 expressionDepositorInsertMCT4 (SLC16A3 Human)
UseLentiviralAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
DNA repair library with 336 sgRNAs
Pooled Library#177664PurposeCRISPR-interference (CRISPRi) library of 366 sgRNAs targeting 118 genes encoding factors involved in DNA repair and associated processesDepositorSpeciesHomo sapiensUseCRISPRAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only