We narrowed to 25,762 results for: Nov;
-
Plasmid#179952PurposepCCI vector encoding YFV-17D lacking nonstructural protein 1 (NS1) but with CreDepositorInsertYFV-17D lacking nonstructural protein 1 (NS1), but with Cre
UseTransneuronal tracingPromoterSP6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR mitfa:KIT K642E
Plasmid#118849PurposeExpresses human KIT K642E mutant and zebrafish mitfa specifically in zebrafish melanocytesDepositorAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2K7-bsd-UBI-tagRFP-KDEL
Plasmid#114179PurposeLentiviral vector for expression of tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseLentiviralTagsKDEL retention signal and signal peptideExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-tagRFP-KDEL
Plasmid#114177PurposeGateway entry clone containing tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseGateway entry cloneTagsKDEL retention signal and signal peptideAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1a_ASCL1_P2A_Hygro_Barcode
Plasmid#120427PurposeBarcoded lentiviral vector to express ASCL1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP313-pAAV-CMV-SaCas9-DIO-pA
Plasmid#113690PurposeA CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC-hTRF1
Plasmid#64164PurposeRetroviral vector expressing human TRF1 with N-terminal MYC tagDepositorAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-CMV-TetO2_3C-Avi-His6_IRES-HA-BirA-ER
Plasmid#113898PurposeMammalian (inducible) protein expression, in vivo biotinylation, bicistronic expression of HA-tagged ER-resident E. coli biotin ligaseDepositorTypeEmpty backboneUseLentiviralTags3C-Avi-His6PromoterCMV-MIE-TetO2Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_eCB2.0
Plasmid#164606PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in Cre positive neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterhSynAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
GIV-WT - FLAG
Plasmid#65947PurposeExpression GIV/Girdin in Mammalian cellDepositorAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
EF1a_FLI1_P2A_Hygro_Barcode
Plasmid#120437PurposeBarcoded lentiviral vector to express FLI1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-LivePAR-Hygro
Plasmid#176063PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertLivePAR
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEEF1D-FLAG (pcDNA 3.1+) LG6-1
Plasmid#37365DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBUN6A11
Plasmid#50579PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp16-HF
Plasmid#157725Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMSCVpuro-Flag-cMyc T58A
Plasmid#20076DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
FLAG-LoxP-GFP-LoxP-SNAP-TERT
Plasmid#71391PurposeHomologues recombination donor plasmid for inserting a FLAG-SNAP-tag at the N-terminus of the TERT locus in human cells. Includes GFP marker flanked by LoxP sites for selection.DepositorAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSecTaq2-hGas6-Myc-6xHis
Plasmid#226523PurposeExpresses TAM Receptor Ligand human GAS6DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC13-hygro
Plasmid#231988PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only