We narrowed to 11,695 results for: nar;
-
Plasmid#69006Purposeactivating MTOR mutationDepositorInsertMTOR-L1460P (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Leucine 1460 to ProlineAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MYC-PGK-blast
Plasmid#190618PurposeLentiviral expression plasmid of human MYC, blast selectionDepositorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1gamma
Plasmid#124141PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
RNF138_pLX307
Plasmid#98368PurposeLentiviral expression of RNF138DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EF1a-Zim3-dCas9-loxP-P2A-EGFP-loxP
Plasmid#188773PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterEF1aAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-E1799K
Plasmid#69009Purposeactivating MTOR mutationDepositorInsertMTOR-E1799K (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Glutamate 1799 to LysineAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FBXL17
Plasmid#236188PurposeExpression of N-terminal tagged FLAG-FBXL17 (H. sapiens, codon-optimized) in human cell lines.DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-R2505P
Plasmid#69015Purposeactivating MTOR mutationDepositorInsertMTOR-R2505P (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Arginine 2505 to ProlineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-T/O-Ds1-mCherry
Plasmid#112855PurposeDox inducible expression in mammalian cells of Ds1 protein fused to mCherry fluorescent proteinDepositorInsertDCHS1 (DCHS1 Human)
TagsmCherryExpressionMammalianPromoterdoxycycline inducible promoterAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hGPR56-IRES-GFP
Plasmid#52297PurposeExpresses human GPR56 and GFP in mammalian cells.DepositorAvailable SinceApril 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-F1888L
Plasmid#69010Purposeactivating MTOR mutationDepositorInsertMTOR-F1888L (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Phenylalanine 1888 to LeucineAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-I2500F
Plasmid#69014Purposeactivating MTOR mutationDepositorInsertMTOR-I2500F (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Isoleucine 2500 to PhenylalanineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-iFlpV
Plasmid#140137Purposecan be used to generate AAV virus that will express light-inducible site-specific iFlpV recombinaseDepositorHas ServiceAAV PHP.eB and AAV1InsertiFlpV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
anti-GFP scFv [N86/38] with sortase tag
Plasmid#204419PurposeMammalian Expression of anti-GFP scFv with a sortase tag for direct dye conjugation. Derived from hybridoma N86/38.DepositorInsertRecombinant mouse scFv targeting GFP (Aequorea victoria)
Tags6xHis tag and Sortase tagExpressionMammalianAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-V2006I
Plasmid#69012Purposeactivating MTOR mutationDepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only