We narrowed to 15,447 results for: grn
-
Plasmid#101077PurposeEncodes gRNA for 3' target of human AHRDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against AHR (AHR Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM1A_1
Plasmid#86297PurposeEncodes gRNA for 3' target of human KDM1ADepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against KDM1A (KDM1A Human)
UseCRISPRAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pM378
Plasmid#173174PurposeExpresses C9-1 gRNA-12xMBS from hU6 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertC9-1 targeting gRNA-12xMBS
UseCRISPRExpressionMammalianPromoterhU6Available sinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_2
Plasmid#163459Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_6
Plasmid#163460Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE WASF1-GFP KI
Plasmid#131502PurposeEndogenous tagging of WASP1/WAVE1: C-terminal (amino acid position: STOP codon)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA and GFP donor (Wasf1 Rat)
ExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianPromoterCMV and U6Available sinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMIA3-Keppel
Plasmid#214446PurposeExpresses eSpCas9 and gRNA targeting Keppel-19 GSHDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRExpressionMammalianPromoterEF1aAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgRosa26
Plasmid#159915PurposeMutagenesis of Rosa26DepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-CTRLg1 (CG509)
Plasmid#139455PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJA55
Plasmid#59935PurposegRNA for cleavage near sqt-1(e1350) locus in C elegansDepositorInsertsqt-1(e1350) gRNA2
UseCRISPRPromoterU6Available sinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_213
Plasmid#133456PurposeH1 promoter expresses customizable Saur-guide; EF1a promoter expresses SpyoCas9 and 2A site provides blasticidin resistanceDepositorInsertControl guide
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Smad3-shRNA
Plasmid#32806DepositorAvailable sinceNov. 18, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LCV2 STING KO
Plasmid#217445PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human STINGDepositorAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
PDG459 V3
Plasmid#226958PurposeCBh-SpCas9-2A-Puro, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYC1446
Plasmid#158720PurposeIntegrating plasmid expressing Sth1 Cas9 and the cognate sgRNADepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-shLuc
Plasmid#73666PurposepSRIEN-RetroQ vector containing control sequence luciferaseDepositorInsertshRNA to Luciferase
UseRetroviralAvailable sinceApril 12, 2016AvailabilityIndustry, Academic Institutions, and NonprofitsCited by