We narrowed to 14,052 results for: crispr grnas
-
Plasmid#87151PurposegltA1-gltA2-udhA-GapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-GapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLHDR_R4
Plasmid#124211PurposegRNA/Cas9 expression for 2nd editing using pSLHDR04DepositorInsertgRNA
UseCRISPRAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-AtU6-HV5
Plasmid#239470PurposeEncodes a gRNA expression cassette driven by the AtU6 promoter.DepositorInsertU6-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-AtU3b-HV5
Plasmid#239477PurposeEncodes a gRNA expression cassette driven by the AtU3b promoter.DepositorInsertU3b-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-At7SL-HV5
Plasmid#239478PurposeEncodes a gRNA expression cassette driven by the At7SL promoter.DepositorInsert7SL-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLHDR_R1
Plasmid#124209PurposegRNA/Cas9 expression for 2nd editing using pSLHDR01, 02DepositorInsertgRNA
UseCRISPRAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgNeo1-hU6-sgNT
Plasmid#177211PurposeExpresses a Neomycin-targeting gRNA (mU6), a non-targeting gRNA (hU6) and Cre-recombinaseDepositorInsertsgNeo/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgEIF4EBP1
Plasmid#128097PurposeCRISPR gRNA against human EIF4EBP1 (4EBP1) with Cas9 from S. pyogenes and 2A-EGFPDepositorInsertCRISPR sgRNA against human 4EBP1 (EIF4EBP1 Human)
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN35-CDKN2A-Ex2-R
Plasmid#110737PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN35-CDKN2A-Ex2-L
Plasmid#110736PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-LacZ-GFP-Puro (BB)
Plasmid#170459PurposeFor cloning gRNA blockDepositorInserthU6-BB-LacZ and EF1A-EGFP-2A-Puro
UseLentiviralExpressionMammalianPromoterhU6 for gRNA and EF1A for EGFP-2A-PuroAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-dCas9-VP64
Plasmid#141104PurposeExpression of gRNA and dCas9-VP64 from the same plasmid for CRISPRaDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJCHph
Plasmid#185863PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a hygromycin B-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; HphMX6
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCKan
Plasmid#185862PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a G418-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; KanMX4
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only