We narrowed to 16,573 results for: omp
-
Plasmid#207810PurposeC-terminal tagged NRF1 for miniTurbo proximity experimentsDepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only
-
p663-UBC-miniTurbo-V5-NRF1
Plasmid#207809PurposeN-terminal tagged NRF1 for miniTurbo proximity experimentsDepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.2
Plasmid#208307PurposeExpresses ABE-RA4.2 in mammalian cellsDepositorInsertTadA-RA4.2-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 HA pCAGGS
Plasmid#206054Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and an exofacial double HA tag in domain IIDepositorInsertcacna1b (CACNA1B Rabbit)
Tags2xHA (internal after Ala526) and GFPExpressionMammalianPromoterCMV/B-actinAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 HA pcDNA3
Plasmid#206053Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and an exofacial double HA tag in domain IIDepositorInsertcacna1b (CACNA1B Rabbit)
Tags2xHA (internal after Ala526) and GFPExpressionMammalianPromoterCMVAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IRES-puro-3xFLAG-NBR1 deltaUBA
Plasmid#204547PurposeExpresses 3xFLAG-tagged NBR1 deltaUBA in mammalian cellsDepositorAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR-SUMO1
Plasmid#114388PurposepDONR vector with SUMO1 geneDepositorInsertSUMO1 (SUMO1 Human)
ExpressionMammalianMutationQ29H compared with NCBI reference NP_003343.1Available SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN, F124D
Plasmid#180648PurposeLentiviral expression vector for SPASTIN. Has F124D mutation. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. SPASTIN starts on M87. Internal ID: WISP20-44.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, F124D mutation, has siRNA resistan…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta PBM + Ezrin
Plasmid#202418PurposeExpression of GFP-tagged PODXL PDZ-binding motif mutation (PBM; doesn't bind NHERF1/2) fused to EZRINDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGIGYF-WFFtoAAA_AH
Plasmid#148939PurposeInsect Expression of DmGIGYF-WFFtoAAADepositorInsertDmGIGYF-WFFtoAAA (Gyf Fly)
ExpressionInsectMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-Dm4EHP-W114A_AH
Plasmid#148909PurposeInsect Expression of Dm4EHP-W114ADepositorInsertDm4EHP-W114A (4EHP Fly)
ExpressionInsectMutation4 silent mutations compared to the sequence given…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-Dm4EHP-W85A_AH
Plasmid#148917PurposeInsect Expression of Dm4EHP-W85ADepositorInsertDm4EHP-W85A (4EHP Fly)
ExpressionInsectMutation4 silent mutations compared to the sequence given…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGIGYF_641-1574_AH
Plasmid#148920PurposeInsect Expression of DmGIGYF_641-1574DepositorInsertDmGIGYF_641-1574 (Gyf Fly)
ExpressionInsectMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-MBP-HsNot9shRNA2res_AG
Plasmid#148828PurposeMammalian Expression of HsNot9-shRNA2resDepositorInsertHsNot9-shRNA2res (CNOT9 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot9_18-285_S
Plasmid#147482PurposeMammalian Expression of HsNot9_18-285DepositorInsertHsNot9_18-285 (CNOT9 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HsUpf1-V161ER162E-siRNAres_Q
Plasmid#147332PurposeMammalian Expression of HsUpf1-V161ER162EDepositorInsertHsUpf1-V161ER162E (UPF1 Human)
ExpressionMammalianMutation5 non silent mutations A69S, E167G, K282R, A442G…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-mScarlet
Plasmid#192509PurposeExpression of N-terminally mGFP and C-terminally mScarlet labelled wildtype FGFR3 (isoform IIIc)DepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mNeurog2 gRNA_1-MS2-Puro
Plasmid#192680PurposeLentiviral expression of sgRNA targeting mIL1RN promoter to activate mouse Neurog2 transcriptionDepositorInsertMouse Neurog2 activating gRNA #1 (Neurog2 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only