We narrowed to 13,244 results for: BASE
-
Plasmid#112056PurposeACTB mRNA tagged with 2 copies of Riboglow (variant A)DepositorInsertACTB (ACTB Human)
TagsRiboglow RNA tagExpressionMammalianMutation2 copies of Riboglow tag (variant A) after stop c…PromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC-elav1.8kb-TALE1-VP64-P10
Plasmid#104609PurposeExpresses TALE1 under the control of a 1.8kb elav enhancer elementDepositorAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS04 [myo-3p::bPGC::SL2::mCherry]
Plasmid#168172PurposeExpression of bPGC in BWMs of C. elegansDepositorInsertbPGC
ExpressionWormAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
KK701: pMAGIC (L3-L2) 3x HA eptitope tag + polyA; hU6::xCas9(3.7) gRNA scaffold
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Sox2 HMEJ donor
Plasmid#97322PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Sox2. AAV backbone.DepositorInsertSox2 HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS1830 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-U6-Fah
Plasmid#199263PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-MbCas12a crRNA-BsmBI cassette (BPK4449)
Plasmid#114088PurposeU6 promoter crRNA entry vector used for all MbCas12a crRNAs (clone spacer oligos into BsmBI cassette)DepositorInsertentry vector for MbCas12a crRNAs
ExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-Puro
Plasmid#110851PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC-mhc2.4kb-TALE3-VP64-P10
Plasmid#104611PurposeExpresses TALE3 under the control of a 2.4kb mhc enhancer elementDepositorAvailable SinceJan. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H150
Plasmid#170345Purpose6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsert6xHis_mT2Del_EPACdDEPCD_Q270E_cp174Cit (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-LMNA
Plasmid#111088PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human Lamin A/C gene.DepositorInsertLamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235)
Plasmid#160646PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.DepositorInserttNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35S, 35SAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KA801: pMVP (L3-L2) HA tag + pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121800PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N-terminus T,S mutations (NT51)
Plasmid#49061PurposeExpresses human NKCC1 mutated Ser and Thr residues in the N-terminus and an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationS150N, S155Q, S170Q, T177A, S183R, S193E, T203A, …PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-PGK-Puro
Plasmid#110858PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_Dbh HMEJ donor
Plasmid#97320PurposeHMEJ donor for fusing a p2A-mCherry-WPRE reporter to mouse Dbh. AAV backbone.DepositorInsertDbh HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only