We narrowed to 981 results for: cas12a
-
Plasmid#223421PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT50
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT52
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL1022
Plasmid#225593PurposeThe backbone vector for rice genome editing is based on HkCas12aDepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL1023
Plasmid#225594PurposeThe backbone vector for rice genome editing is based on PrCas12aDepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL1024
Plasmid#225595PurposeThe Dual Pol II backbone vector for rice genome editing is based on Mb3Cas12aDepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL1025
Plasmid#225596PurposeThe STU backbone vector for rice genome editing is based on Mb3Cas12aDepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL1026
Plasmid#225597PurposeThe STU backbone vector for rice genome editing is based on Mb3Cas12a-R (D172R)DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_052
Plasmid#136474PurposeLentiviral expression of AsCas12a gRNADepositorInsertPuromycin resistance
UseLentiviral and Synthetic BiologyPromoterEF1aAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL1029
Plasmid#225600PurposeThe STU backbone vector for tomato genome editing is based on Mb3Cas12a-RRR (D172R/N573R/K579R)DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK526
Plasmid#155387PurposePphlF-TA4 crRNAs, 1x cascade. dCas12a (D917A) + PA4-mVenusDepositorInsertsdCas12a (F. novicida)
PA4-mVenus
PphlF-TA4 in dCas12a oscillator crRNAs
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEL1027
Plasmid#225598PurposeThe STU backbone vector for rice genome editing is based on Mb3Cas12a-RRR (D172R/N573R/K579R)DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL1028
Plasmid#225599PurposeThe STU backbone vector for maize genome editing is based on Mb3Cas12a-RRR (D172R/N573R/K579R)DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJK528
Plasmid#155388PurposedCas12a oscillator, reverse crRNAs + PA4-mVenus. (Integration of 511; pOSIP)DepositorInsertsdCas12a (F. novicida)
PA4-mVenus
dCas12a oscillator crRNAs
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)Available SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK520
Plasmid#155386PurposePphlF-TA1 crRNAs, 2x cascade. dCas12a (D917A) + PA4-mVenusDepositorInsertsdCas12a (F. novicida)
PA4-mVenus
PphlF-TA1 in dCas12a oscillator crRNAs
UseCRISPRExpressionBacterialMutationD917A (nuclease-deactivating)AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFH47
Plasmid#125812PurposeLevel0 LbCas12a, human codon optimizedDepositorInsertLbCas12a, human codon optimized
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH17
Plasmid#125803PurposeLevel0 LbCas12a, rice codon optimizedDepositorInsertLbCas12a, rice codon optimized
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only