We narrowed to 66,514 results for: des.1
-
Viral Prep#50475-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 26, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1 phiC31
Plasmid#68310PurposeIn vitro transcription vector to generate phiC31 mRNA (i.e. for zebrafish injection).DepositorInsertphiC31
UseRna transcriptionPromoterCMVAvailable SinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
tau/pET29b
Plasmid#16316DepositorInserttau (MAPT Human)
ExpressionBacterialAvailable SinceDec. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
Klotho (membrane)
Plasmid#17712DepositorAvailable SinceApril 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_AGIA-AirID
Plasmid#182210PurposeExpress AirID in mammalian cells.DepositorInsertAGIA-AirID
TagsAGIA-tagExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV/TO RasV12 Puro (w119-1)
Plasmid#22262DepositorAvailable SinceDec. 15, 2009AvailabilityAcademic Institutions and Nonprofits only -
PyronicSF/pcDNA3.1(-)
Plasmid#124812PurposeHighly resposive GFP-based pyruvate nanosensor.DepositorInsertPyronicSF
ExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Cry2FL-VP64
Plasmid#60554PurposeExpresses Cry2FL-VP64 in mammalian cellsDepositorInsertCry2FL-VP64
TagsFLAG, HA tag, and SV40 NLSExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
shp63alpha pLKO.1 puro
Plasmid#19120DepositorInsertsmall hairpin RNA against tumor protein p63 (TP63 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pHAGE TRE dCas9-KRAB
Plasmid#50917PurposeTet-regulatable dCas9-KRAB 2nd generation lentiviral expression vectorDepositorInsertdCas9
UseCRISPR and LentiviralTags3xHA and KRABExpressionMammalianMutationD10A, H840A (catalytically inactive)PromoterTREAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 SARS-CoV-2 N
Plasmid#158079PurposeExpresses SARS-CoV-2 nucleocapsid protein in mammalian cellsDepositorInsertSARS-CoV-2 nucleocapsid (N )
ExpressionMammalianAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 puro Rb shRNA
Plasmid#10670DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)-mCherry (AAV8)
Viral Prep#50474-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA. hSyn-driven hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE (AAV1)
Viral Prep#104488-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA. Synapsin-driven GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV5)
Viral Prep#50465-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.sh.beta-catenin.1248
Plasmid#19761DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
SRa-HA-SUMO1 (Sentrin 1)
Plasmid#17359DepositorAvailable SinceMarch 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-HTNC
Plasmid#13763PurposeFor expression and purification of a His-TAT-NLS-Cre fusion; HIV-TAT promotes cellular uptake of recombinant Cre into mammalian cells.DepositorInsertHis-TAT-NLS-Cre
UseBaculovirusTagsHis Tag, NLS, and TATExpressionBacterialPromoterp10 promoterAvailable SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only