We narrowed to 14,950 results for: RING
-
Plasmid#166848PurposeExpresses Atg1 with ATG17 3'UTR in yeasts.DepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only
-
mr in pUASP
Plasmid#112981PurposeP element vector for transposon insertion of mr (APC2) into Drosophila genomeDepositorInsertmr (APC2) (mr Fly)
UseP insertion vectorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIhh1.3K-Luc
Plasmid#53604PurposeReporter construct containing a 1.3 kb promoter region of the Ihh gene in front of a luciferase gene for in vitro DNA transfection assaysDepositorInsertIhh promoter
UseLuciferase; ReporterAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPPC027.306
Plasmid#171149PurposeBiopterin production pathway with J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-GTPCH_J3-BBa_J23117-PTPS_J3-BBa_J23117-SR
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAtCas9-H840A_1
Plasmid#91162PurposeCas9 only expression, Cas9 Type: AtCas9_H840A (nickase), Plant Selection: 2x35S:hpt IIDepositorInsertAtCas9_H840A (nickase)
UseCRISPRExpressionPlantMutationH840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pTaCas9-H840A_6
Plasmid#91173PurposeCas9 only expression, Cas9 Type: TaCas9_H840A (nickase), Plant Selection: PvUbi2:barDepositorInsertTaCas9_H840A (nickase)
UseCRISPRExpressionPlantMutationH840AAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
POT11-RFP
Plasmid#65327Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS424-URR
Plasmid#65330Purposehigh copy number plasmid as receiving vector for exogenous pathwayDepositorInsertURR1-RFP-Leu2-URR2
UseSynthetic BiologyAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT5-RFP
Plasmid#65321Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS414-URR
Plasmid#65329PurposeCEN plasmid as receiving vector for exogenous pathwayDepositorInsertURR1-RFP-Leu2-URR2
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT3-RFP
Plasmid#65319Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
POT9-RFP
Plasmid#65325Purposereceiving vector of standard transcription units(TUs) in YeastFab work, useful for further assemblyDepositorInsertRFP
UseSynthetic BiologyAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2210 - [1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
Plasmid#159864PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMP472
Plasmid#134997PurposeInterspersed Reporter. Fluorescent reporter to be used with m6A readers and writers. (8xZF binding sites + 14xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertInters. (8XZFBS 14XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP498
Plasmid#134998PurposeClustered Reporter. Fluorescent reporter to be used with m6A readers and writers. (5xZF binding sites + 63xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertClust. (5XZFBS 63XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP650
Plasmid#135000PurposeVP64-m6A Reader. Activates transcription near Gm6ATC sites. pUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoRDepositorInsertpUBC-DpnI(aa146-254)-VP64-V5 pGK-ZeoR
UseLentiviral and Synthetic BiologyTagsDpnI(aa146-254), V5 tag, and VP-64ExpressionMammalianMutationDpnI truncated to aa146-254Available SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJAG98-mTurquoise2-FHA2-AURKB substrate-YPet
Plasmid#83286Purposeuntargeted Aurora B FRET sensor with mTurquoise2 and YPet FRET pairDepositorInsertmTurquoise2-FHA2-AURKB substrate-YPet
UseRetroviralExpressionMammalianAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0802
Plasmid#91023PurposeModule A, Promoter: AtUbi10, Gene: Csy4-P2A-AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertCsy4-P2A-AtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterAtUbi10Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only