We narrowed to 9,093 results for: sgRNA
-
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
EMX1*_sgRNA
Plasmid#100558PurposeExpresses EMX1* sgRNA. Target sequence: (G)GAGTCCGAGCAGAAGAAGAA. Same target sequence as #100555, except with an additional 5' G.DepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP2754
Plasmid#160666PurposeMobile CRISPRi sfGFP 'test', empty sgRNADepositorInsertempty sgRNA (BsaI)
ExpressionBacterialAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP2836
Plasmid#160674PurposeMobile CRISPRi sfGFP 'test', gmc6 sgRNADepositorInsertgmc6 (gfp) sgRNA
ExpressionBacterialAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWT062e
Plasmid#107910PurposeW2m.2-3 plasmid. Contains U6-LacI-sgRNA A and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-LacI-sgRNA A
ExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAL-pyk_T
Plasmid#74070PurposepAL374 plasmid carrying the pyk (T) sgRNA targeting the template strand of pyk, SpecRDepositorInsertsgRNA pyk (T)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable SinceApril 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAL-pck_T
Plasmid#74068PurposepAL374 plasmid carrying the pck (T) sgRNA targeting, the template strand of pck, SpecRDepositorInsertsgRNA pck (T)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xPP7_SL]
Plasmid#68424PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertINT construct bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mouse Brie kinome pooled library, guides 1-4 in lentiGuide-Puro backbone
Pooled Library#75316PurposeMouse sgRNA library in backbone lentiGuide-Puro targeting 713 kinase genes and containing 2,852 unique sgRNAs along with 100 non-targeting controlsDepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSK-mU6-Cj-sgRNA-SV40-puro
Plasmid#192128PurposeExpresses Cj-SgRNA scaffold cloned with BbsI and puromycin resistance geneDepositorInsertCj-SgRNA scaffold
ExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19-Cas9_handle-S.pyogenes_terminator-PBBa_J23117-Cmr
Plasmid#190794PurposeTemplate vector to amplify pieces for creating multiplex sgRNA-arrays.DepositorInsertsgRNA-scaffold only
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos9_AmpR
Plasmid#119152PurposeEncodes sgRNA targeting position 9 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 9 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAT005
Plasmid#171632Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting B2M and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-B2M
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-SLC35B2-sgRNA
Plasmid#154860PurposeLentiviral expression of Cas9 and sgRNA targeting SLC35B2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB[U6-3 wex2 PUb-DsRed]
Plasmid#169010PurposeFor germline transformation. Expresses white exon 2 sgRNA and DsRed marker in all cells.DepositorInsertwhite ex2 sgRNA
UsePiggybacExpressionInsectPromoterDrosophila melanogaster U6:3Available SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_GAPDH-sgRNA
Plasmid#249575PurposeExpresses SpCas9, GFP, and sgRNA targeting GAPDH.DepositorInsertGAPDH-sgRNA
UseCRISPRPromoterU6 promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only