We narrowed to 9,093 results for: sgRNA
-
Pooled Library#75317PurposeMouse sgRNA library in backbone lentiCRISPRv2 targeting 713 kinase genes and containing 2,852 unique sgRNAs along with 100 non-targeting controlsDepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.PAC
Plasmid#57829PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-PAC
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
sgOpti
Plasmid#85681PurposeLentiviral vector to express sgRNAs. The cloning site is BsmBI.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZR060_CROPseq-sgCtrl-CRISPRi
Plasmid#180269PurposeLentiviral CROPseq vector expressing non-targeting control sgRNA for CRISPRiDepositorInsertNo-Target Control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMZ289
Plasmid#59898PurposeCombination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: sgRNA targeted against ade6-M210DepositorInsertsCas9
rrk1:sgRNA
UseCRISPRExpressionYeastMutationSilent muation of the CspCI siteAvailable SinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_1
Plasmid#64036PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRPromoterU6Available SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_CREB1_2
Plasmid#64940PurposeExpresses gRNA against human CREB1 along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_2
Plasmid#64047PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRPromoterU6Available SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spa)_ctrA
Plasmid#133342Purposefor constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO3_AH
Plasmid#148855PurposeMammalian Expression of HsAGO3-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-3
Plasmid#237892PurposeCre-KO AAV vector#3 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-Lmna sgRNA
Plasmid#206979PurposeExpresses SauriABE8e by EFS promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertLmna sgRNA
UseAAV; Adenine base editorPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgItgb5 v3
Plasmid#158038Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse Itgb5DepositorInsertItgb5 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Cre sgRipk4 v3
Plasmid#158035Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse Ripk4DepositorInsertRipk4 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits