We narrowed to 9,217 results for: sgRNA
-
Plasmid#154860PurposeLentiviral expression of Cas9 and sgRNA targeting SLC35B2DepositorAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pB[U6-3 wex2 PUb-DsRed]
Plasmid#169010PurposeFor germline transformation. Expresses white exon 2 sgRNA and DsRed marker in all cells.DepositorInsertwhite ex2 sgRNA
UsePiggybacExpressionInsectPromoterDrosophila melanogaster U6:3Available sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK73.ChrII_ttTi5605.sgRNA
Plasmid#194058PurposesgRNA targeting ChrII_ttTi5605 locus of the C. elegans genomeDepositorInsertChrII_ttTi5605 sgRNA
ExpressionWormPromoterU6Available sinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEM040 [Multiome Perturb-seq sgRNA expression vector]
Plasmid#224898PurposeLentiviral CROP-seq vector with lineage barcode cassette and T7 promoter for ID amplification from cDNA, engineered for high-efficiency ID assignment in Multiome Perturb-seq experimentsDepositorInsertseGFP
LacZ fragment (removed by digestion with BstXI/BlpI for sgRNA cloning)
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable sinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pL-CRISPR.SFFV.PAC
Plasmid#57829PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-PAC
UseCRISPR and LentiviralTagsFLAGAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sgOpti
Plasmid#85681PurposeLentiviral vector to express sgRNAs. The cloning site is BsmBI.DepositorPublicationTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZR060_CROPseq-sgCtrl-CRISPRi
Plasmid#180269PurposeLentiviral CROPseq vector expressing non-targeting control sgRNA for CRISPRiDepositorInsertNo-Target Control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMZ289
Plasmid#59898PurposeCombination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: sgRNA targeted against ade6-M210DepositorInsertsCas9
rrk1:sgRNA
UseCRISPRExpressionYeastMutationSilent muation of the CspCI siteAvailable sinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_1
Plasmid#64036PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
UseCRISPRPromoterU6Available sinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_CREB1_2
Plasmid#64940PurposeExpresses gRNA against human CREB1 along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
UseCRISPRAvailable sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_2
Plasmid#64047PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
UseCRISPRPromoterU6Available sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO3_AH
Plasmid#148855PurposeMammalian Expression of HsAGO3-sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHsAGO3-sgRNA (AGO3 S.pyogenes)
UseCRISPRExpressionMammalianAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spa)_ctrA
Plasmid#133342Purposefor constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Mouse Brie kinome pooled library, guides 1-4 in lentiGuide-Puro backbone
Pooled library#75316PurposeMouse sgRNA library in backbone lentiGuide-Puro targeting 713 kinase genes and containing 2,852 unique sgRNAs along with 100 non-targeting controlsDepositorAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only