We narrowed to 19,374 results for: Tat
-
Plasmid#42591DepositorInsertmutated C-terminal portion of calmodulin gene (M76-K148)
TagsHis and TEVExpressionBacterialMutationchanged Phenylalanine 92 to Glutamine acid, Isole…PromoterT7Available SinceMarch 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
ninaE-dsocs
Plasmid#26857DepositorInsertSlow Termination of Phototransduction (stops Fly)
TagsmycExpressionInsectMutationThis STOPS construct contains a mutated/truncated…Available SinceApril 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpCas9(D10A)-BPNLS-P2A-EGFP (CA77)
Plasmid#208290PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpCas9(D10…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pW210-pPB-GA-inducible-CRISPRa-sa_dCas9-VPR-hygR
Plasmid#170808PurposePiggyBac vector to express GA-inducible VPR-Sa_dCas9 with hygromycin resistanceDepositorInsertsExpressionMammalianMutationSynonymous mutation in PYL1 to remove XhoI site (…Available SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_UBM1*2* POLI
Plasmid#131232PurposeMammalian expression of an N-terminally FLAG-tagged DNA polymerase iota mutant, containing point mutations in both UBM domainsDepositorInsertDNA polymerase iota (POLI Human)
TagsFLAGExpressionMammalianMutationContains inactivating mutations in both ubiquitin…PromoterCMV enhancer + CMV promoterAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAP-COMP-blac-flag-his
Plasmid#111001PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertaminopeptidase P (APP) (PF14_0517 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-TSC2(AA,3Q)
Plasmid#192444PurposeEncodes mCherry-tagged TSC2 isoform 5 with S939A, T1439A, K1614Q, K1615Q, R1616Q mutations to disrupt Akt phosphorylation and GAP activity.DepositorInsertmCherry-TSC2(S939A,T1439A,K1614Q,K1615Q,R1616Q ) (TSC2 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationTSC2 Ser 939 and Thr 1439 (equivalent to 1462 in …PromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Human, Synthetic)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FullLength-TET1-CXXC/LLAA
Plasmid#124399PurposeFull-length mutant TET1 (L897A/L900A), missing zinc finger domain (585-624), used to PiggyBAC rescue the function of TET1/2 DKO cellsDepositorInsertFLAG-FullLength-TET1 CXXC zinc finger deletion (585-624) and L897A/L900A mutations (TET1 Human)
TagsFlagExpressionMammalianMutationCXXC zinc finger deletion (aa 585-624) and L897A/…Available SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
GEST-COMP-blac-flag-his
Plasmid#111015PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertgamete egress and sporozoite traversal protein (GEST) (PF3D7_1449000 )
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
SOAP-COMP-blac-flag-his
Plasmid#110997PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted ookinete adhesive protein (SOAP) (PF3D7_1404300 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CTRP-COMP-blac-flag-his
Plasmid#110994PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertcircumsporozoite- and TRAP-related protein (CTRP) (CTRP Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
P25-COMP-blac-flag-his
Plasmid#110991PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertookinete surface protein P25 (PF10_0303 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1310500-COMP-blac-flag-his
Plasmid#110967PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertconserved Plasmodium protein (PF3D7_1310500 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
RON2-COMP-blac-flag-his
Plasmid#110962PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertrhoptry neck protein 2 (RON2) (PF3D7_1452000 Synthetic)
TagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2 ZfUbi::cMyc-oDam_f_GFPoNLS
Plasmid#85821PurposeiDamID plasmid. To stably and ubiquitously express the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertZf Ubi::cMyc oDam_f_GFPoNLS
UseTol2 based vectorTagscMyc N terminal to oDam_f_GFPoNLS and oNLS (optim…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-7 in pcDNAI/Amp
Plasmid#54473PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-7. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only