We narrowed to 28,641 results for: Tat
-
Plasmid#185036Purpose400 nt l31 promoter region, l31 5'UTR G79U mutation, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationG79U mutation of rpmE 5'UTR, Only first 90 n…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Q54A
Plasmid#217912PurposeA plasmid encoding the hydrogel-forming protein PXP with the Q54A coil mutationDepositorInsertPXP Q54A
Tags6x His (N and C term)ExpressionBacterialMutationGlutamine at position 55 and 267 mutated to Alani…PromoterT5Available SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
T40A
Plasmid#217911PurposeA plasmid encoding the hydrogel-forming protein PXP with the T40A coil mutationDepositorInsertPXP T40A
Tags6x His (N and C term)ExpressionBacterialMutationThreonine at position 41 and 253 mutated to Alani…PromoterT5Available SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS9
Plasmid#218717PurposeExpresses N-terminally EGFP-tagged BBS9 in mammalian cellsDepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4316
Plasmid#200171PurposePflp-18 LoxP EBFP (stop) LoxP twk-40(gf) GFP unc-54 3' UTR C.elegans AVA and other neurons expression of twk-40(gf) GFPDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4018
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1-SRT1
Plasmid#203171PurposeYeast expression vector for yeast SRT1DepositorAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
VF-Sensor
Plasmid#208927Purposein vitro RSK-Sensor for luminescent detection of RSK-activityDepositorAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
PDE4B-Sensor
Plasmid#208929Purposein vitro JNK-Sensor for luminescent detection of JNK-activityDepositorInsertPDE4B docking sequence+Phospho site and Smbit (PDE4B Human)
TagsHISx6, MBP, and SmbitExpressionBacterialPromoterT7Available SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
mApple-1xHp
Plasmid#214409PurposeLipid droplet and ER localization of 1xHp of Spastin fused to mAppleDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1015A
Plasmid#213415PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnTS-E1015A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1021A
Plasmid#213416PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnTS-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1015A
Plasmid#213412PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnCS-E1015A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1021A
Plasmid#213413PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnCS-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
Plasmid#206967PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA7.10, SpG N
UseAAVPromoterCMVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA8e-SpG N aa2-713-InteinN
Plasmid#206968PurposeExpresses TadA8e and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA8e, SpG N
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033A
Plasmid#211835PurposeVinculin tension sensor (VinTS) with vinculin S1033 unphosphorylatable point mutation (S1033A), in lentiviral expression vector.DepositorInsertVinculinTS-S1033A (VCL Chicken, Synthetic)
UseLentiviralMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only