We narrowed to 10,082 results for: crispr plasmids
-
Plasmid#199223PurposeDonor plasmid with CCR5 target sites for ITPN or HMEJ knock-in at the human CCR5 safe harbour locusDepositorInsertExpression unit for mCherry - monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)
UseGene targeting donor plasmidExpressionMammalianPromoterHuman PGK1 gene promoterAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-TO-g0 (FLP-IN)
Plasmid#236120PurposePlasmid encoding g0 guide RNA under control of CMV promoter with two TetR binding sites, used to equalize plasmid masses for transfectionDepositorInsertg0
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pattB-LSL-AAVR-F2A-spCas9
Plasmid#202459PurposeThe plasmid backbone used to generate the recombination template to generate the SELECTIV mice through Integrase Mediated Transgenesis. Allows for Cre-dependent expression of AAVR and Cas9.DepositorInsertAAVR (AU040320 Mouse)
UseCRISPR, Cre/Lox, and Mouse TargetingTagsmCherry fusionExpressionMammalianPromoterCAGAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-spCas9
Plasmid#231404PurposeExpresses spCas9 from hSyn promoterDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBh-NLS_hfCas13d(RfxCas13d_N2V8)_HA_NLS-pA-U6-DR-BpiI-BpiI-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#190034Purposevector for encoding a human codon-optimized High-fidelity RfxCas13d (hfCas13d) driven by CBh promoter, guide RNAs compatible with RfxCas13d driven by hU6, EGFP and mCherry driven by SV40 promotersDepositorInserthumanized hfCas13d
ExpressionMammalianMutationA134V,A140V,A141V,A143VPromoterCBh, SV40, hU6Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAi14-luc-MC
Plasmid#87113Purposeminicircle parental backbone plasmid including luc-pA knock-in donor and one cutting site for HITIDepositorInsertLuciferase-SV40pA
UseCRISPR and LuciferaseAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-TO-hNGN2-BSD-mApple
Plasmid#124229PurposeTargets the human CLYBL safe harbor locus for integration of dox-inducible NGN2 for differentiation of iPSCs into cortical neurons. Contains a floxed BSD-NLS-mApple selection cassette.DepositorInsertNGN2 (NEUROG2 Human)
ExpressionMammalianAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPD0039_CROP-seq-CAR-Puro
Plasmid#242532PurposeCAR T screeningDepositorInsertCD19-BB CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6d
Plasmid#207854PurposeMammalian expression of PE6d prime editorDepositorInsertPE6d
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrt(T128N, V223Y, D200C)Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPD0035_CROPseq-CAR-Puro_CD19-28z
Plasmid#242983PurposeCD19-28z FMC63 CARDepositorInsertCD19-28z FMC63 CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6a
Plasmid#207851PurposeMammalian expression of PE6a prime editorDepositorInsertPE6a
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationEc48rt(E60K, K87E, E165D, D243N, R267I, E279K, K3…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
ExpressionBacterial and MammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmaxRNaseHtrunc
Plasmid#207858PurposeMammalian expression of PEmaxDRNaseH prime editorDepositorInsertPEmaxDRNaseH
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrtAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
UBC-TLR4-HA hygro
Plasmid#246905PurposeExpresses HA-tagged human TLR4 in mammalian cellsDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only