We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCamKII-Cre-pU6-SpCas9gRNAentry
Plasmid#210391PurposeAAV plasmid encoding the CamKII promoter driving Cre expression, along with SpCas9 gRNA entry cassette (RFP dropout)DepositorInsertAAV-(ITR)-pCamKII-NLS-Cre-WPRE-bGHpA-(rev)-SpCas9_gRNA-BsmBI_RFPcassette-hU6-(ITR) (NJA158)
UseAAV and CRISPRExpressionMammalianPromoterCamKII promoter for Cre, human U6 promoter for Sp…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
IA201: pMAGIC (R4-R3) NLS-Sa dCas9-NLS
Plasmid#121821PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IH601: pMAGIC (R4-R3) NLS-Sa Cas9-NLS
Plasmid#121827PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS SaCas9 (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-Cas9 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-mCherry
Plasmid#217005Purposelentiviral plasmid for gRNA cloning with selectable mCherry expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-tagBFP
Plasmid#217007Purposelentiviral plasmid for gRNA cloning with selectable tagBFP expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-dest
Plasmid#69538PurposeDestination plasmid for gRNA concatenation Golden Gate cloningDepositorTypeEmpty backboneAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-mMaroon
Plasmid#217008Purposelentiviral plasmid for gRNA cloning with selectable mMaroon expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC572
Plasmid#127973PurposeAMA1 plasmid with pyrG selection marker, and USER cassette (PacI/Nt.BbvCI)DepositorInsertpyrG
UseFungal expressionExpressionBacterialPromoternative promoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC573
Plasmid#127974PurposeAMA1 plasmid with argB selection marker, and USER cassette (PacI/Nt.BbvCI)DepositorInsertargB
UseFungal expressionExpressionBacterialPromoternative promoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWT019b
Plasmid#107894PurposeW1.2 plasmid. Contains PTetO-sd2U-Cas9, PLacO-sgRNA1, PRha-sgRNA2 (sgRNA1-G19T-G20C) and is part of CAMERA 1.2DepositorInsertPTetO-sd2U-Cas9, PLacO-sgRNA1, PRha-sgRNA2 (sgRNA1-G19T-G20C)
ExpressionBacterialAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEVA19_sgRNA-C1_M13ps
Plasmid#231411PurposeM13 phagemid that expresses sgRNA-C1 (= sgRNA A5T from Nielsen et al., 2014) from a strong constitutive promoter. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ272.)DepositorInsertsgRNA-C1
UseSynthetic BiologyAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-dsRed
Plasmid#217006Purposelentiviral plasmid for gRNA cloning with selectable dsRed expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only