We narrowed to 12,981 results for: NUC

#174793

Bacterial expression of an inactive PARP1 (W318R disrupts interdomain communication and HD subdomain unfolding)

Joan Conaway

Ooi et al Proc Natl Acad Sci U S A. 2021 Sep 7;118

Sept. 23, 2021

Academic Institutions and Nonprofits only

#74059

retroviral expression plasmid for human NFATc1/bC with C-terminal BirA-biotinylation signal and TEV celavage site

Ria Baumgrass

Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.

June 8, 2016

Academic Institutions and Nonprofits only

#174795

Bacterial expression of wild type PARP1 mutant (A762V is reversion of the common V762A polymorphism)

Joan Conaway

Ooi et al Proc Natl Acad Sci U S A. 2021 Sep 7;118

Sept. 23, 2021

Academic Institutions and Nonprofits only

#79880

Beta-actin2 promoter driving Avi-tagged protein containing Cerulean protein fused to zebrafish Rpl10a ribosomal unit (Tryon et al. 2012); flanked by Tol2 sequences

Tatjana Sauka-Spengler

Trinh et al Cell Rep. 2017 Apr 11;19(2):425-440. doi

Oct. 11, 2016

Academic Institutions and Nonprofits only

#73078

human E2F7 minigene (exons 11,12,13/introns cassette) with PP7-tag on 5'-end

Stefan Stamm

Falaleeva et al Proc Natl Acad Sci U S A. 2016 Mar 22;11

Dec. 7, 2018

Academic Institutions and Nonprofits only

#169166

Baculoviral transfer vector for the expression of SARS-CoV-2 nsp15 in insect cells

John Diffley

Canal et al Biochem J. 2021 Jul 16;478(13):2465-2479

July 6, 2021

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#126457

Expresses Cas9-10xFlag-TdT in mammalian cells.

Chang Liu

Loveless et al Nat Chem Biol. 2021 Jun;17(6):739-747. d

June 4, 2019

Academic Institutions and Nonprofits only

#79889

Donor cassette containing HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection gene

Tatjana Sauka-Spengler

Trinh et al Cell Rep. 2017 Apr 11;19(2):425-440. doi

Oct. 11, 2016

Academic Institutions and Nonprofits only

#80068

Beta-actin2 promoter driving C-term Avi-tagged protein containing Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1); flanked by Tol2 sequences

Tatjana Sauka-Spengler

Trinh et al Cell Rep. 2017 Apr 11;19(2):425-440. doi

Oct. 11, 2016

Academic Institutions and Nonprofits only

#65553

Plasmid for Bxb1-mediated recombination of the mCh-Dnmt3b1 cDNA into a MIN-tagged locus using Neomycin selection

Sebastian Bultmann

Mulholland et al Nucleic Acids Res. 2015 May 24. pii: gkv

Aug. 31, 2015

Academic Institutions and Nonprofits only

#118622

expression of mChe-tagged cdc42E7-E6-3'UTR under pSyn promoter for primary neurons

Marina Chekulaeva

Ciolli Mattioli et al Nucleic Acids Res. 2018 Dec 22. pii: 525

March 28, 2019

Academic Institutions and Nonprofits only

#73425

Reporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

March 1, 2016

Academic Institutions and Nonprofits only

#65551

Plasmid for Bxb1-mediated recombination of the GFP-Dnmt3b1 cDNA into a MIN-tagged locus using Neomycin selection

Sebastian Bultmann

Mulholland et al Nucleic Acids Res. 2015 May 24. pii: gkv

Aug. 31, 2015

Academic Institutions and Nonprofits only