We narrowed to 11,310 results for: AGA
-
Plasmid#184977PurposeExpress -Eco1 LYP1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 12
ExpressionYeastMutationLYP1 donor E27stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.109
Plasmid#184978PurposeTest effect of extending a1/a2 on LYP1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 27 v1
ExpressionYeastMutationLYP1 donor E27stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.107
Plasmid#184976PurposeTest effect of extending a1/a2 on CAN1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, CAN1 G444X, a1/a2 length: 27 v1
ExpressionYeastMutationCAN1 donor G444stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.106
Plasmid#184975PurposeExpress -Eco1 CAN1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, CAN1 G444X, a1/a2 length: 12
ExpressionYeastMutationCAN1 donor G444stopPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pW402-lenti-sg2-mmItgb1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#189951PurposeLentiviral vector to co-express a mouse Itgb1 spsgRNA (sg2-Itgb1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR; Itgb1 spsgRNA #2
UseLentiviralExpressionMammalianAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e3
Plasmid#190685PurposesgRNA targeting enhancer 3 of MYCDepositorInsertsgRNA targeting enhancer 3 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cherry-Plekhh1 5 silent mutations
Plasmid#187373PurposeExpresses human Plekhh1 with 5 silent mutations labelled with CherryDepositorInsertPlekhh1 with 5 silent mutations
TagsmCherryExpressionMammalianMutationFive silent mutations at the Plekhh1 siRNA site (…PromoterCMVAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK15 pCAS-Tyr-[gRNA: 5=ARS308] (SplitKanR, AmpR)
Plasmid#178999PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLeGO.sgGata1.4.RUNX1A.iG2
Plasmid#181976Purposegene knock out of mouse GATA1, overexpression of 3xFLAG-RUNX1A (human)DepositorAvailable SinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFB_ROSA26_SpCas9_gRNAs
Plasmid#174703PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.DepositorInsertSpCas9 dual gRNAs
UseAAVAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC030.306
Plasmid#171151PurposeMevalonate production pathway with J306 scRNA on pBBR1-GmR plasmidDepositorInsertsJ306 scRNA
J3-BBa_J23117-mvaES
UseCRISPRExpressionBacterialPromoterBBa_J23119 and J3-BBa_J23117Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only