We narrowed to 29,279 results for: tat
-
Plasmid#213412PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnCS-E1015A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1021A
Plasmid#213413PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnCS-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
Plasmid#206967PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA7.10, SpG N
UseAAVPromoterCMVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA8e-SpG N aa2-713-InteinN
Plasmid#206968PurposeExpresses TadA8e and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA8e, SpG N
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033A
Plasmid#211835PurposeVinculin tension sensor (VinTS) with vinculin S1033 unphosphorylatable point mutation (S1033A), in lentiviral expression vector.DepositorInsertVinculinTS-S1033A (VCL Chicken, Synthetic)
UseLentiviralMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033D
Plasmid#211893PurposeVinculin tension sensor (VinTS) with vinculin S1033 phosphomimetic point mutation (S1033D), in lentiviral expression vector.DepositorInsertVinculinTS-S1033D (VCL Chicken, Synthetic)
UseLentiviralMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinCS-S1033A
Plasmid#211894PurposeVinculin conformation sensor (VinCS) with vinculin S1033 unphosphorylatable point mutation (S1033A), in lentiviral expression vector.DepositorInsertVinculinCS-S1033A (VCL Chicken, Synthetic)
UseLentiviralMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinCS-S1033D
Plasmid#211895PurposeVinculin conformation sensor (VinCS) with vinculin S1033 phosphomimetic point mutation (S1033D), in lentiviral expression vector.DepositorInsertVinculinCS-S1033D (VCL Chicken, Synthetic)
UseLentiviralMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
MIGR1_FLAG_TAL1-long_dt tomato
Plasmid#210639PurposeOverexpression of TAL1-longDepositorInsertTAL1-long (TAL1 Human)
UseRetroviralAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V222A RAD23B
Plasmid#201580PurposeExpresses a variant of human RAD23B containing mutation V222A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation V222AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F400A RAD23B
Plasmid#201581PurposeExpresses a variant of human RAD23B containing mutation F400A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation F400AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
ALIX(P801G)-mNeonGreen
Plasmid#191192PurposeFull-length ALIX with P801G mutation in proline-rich domain; C-terminally tagged with mNeonGreen.DepositorInsertALIX (P801G) (PDCD6IP Human, Synthetic)
Tags6xHIS and mNeonGreenExpressionMammalianMutationPro 801 mutated to GlyPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
1533_pAAV-CB-AcGFP-BirA-HA
Plasmid#208201PurposeControl for FKBP12-BirA constructDepositorTypeEmpty backboneUseAAVPromoterChicken beta actinAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-GFP
Plasmid#205179PurposeExpresses rat CENP-O C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorInsertCENP-O (Cenpo Rat)
UseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationWild type rat CENP-OPromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB399
Plasmid#203635PurposeModule for the expression of geneticin resistance, Nluc under PgpdA promoter and luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertFB367+FB396
UseSynthetic BiologyAvailable SinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX SYT9 C2B D330, 332N
Plasmid#195705PurposeBacterial expression plasmid encoding GST-tagged SYT9 C2B domain with D330, 332N mutationsDepositorInsertSyt9 (Syt5 Mouse)
TagsGSTExpressionBacterialMutationencodes amino acids 253-344 of mouse SYT9 with D3…Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX SYT9 C2AB D197,199,330,332N
Plasmid#195706PurposeBacterial expression plasmid encoding GST-tagged SYT9 C2AB domain with D197, 199, 330, 332N mutationsDepositorInsertSyt9 (Syt5 Mouse)
TagsGSTExpressionBacterialMutationencodes amino acids 104-386 of mouse SYT9 with D1…Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB400
Plasmid#203636PurposeModule for the expression of geneticin resistance, Nluc under PgpdA promoter and luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertFB367+FB397
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NUS1
Plasmid#203169PurposeYeast expression vector for yNUS1DepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only