We narrowed to 15,760 results for: LIS
-
Plasmid#90361PurposeWnt - TCF/LEF gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterWntAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW yAT1.03R122KR126K
Plasmid#132782PurposeNon-binding version of the FRET biosensor for ATP measurements in budding yeastDepositorInsertyAT1.03R122KR126K ymTq2-tdTomato
ExpressionYeastMutationR122K, R126KAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-EbpA_g1
Plasmid#153517PurposesgRNA for ebpA gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertpnisA-sgRNA(EbpA_g1)-dCas9 scaffold
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHT-6xR.ads-PxylA-DI
Plasmid#47386PurposeExpresses ads under Pgrac promoter (inducible by IPTG) and expresses dxs and idi under PxylA promoter (inducible by xylose) in bacteriaDepositorInsertsads
dxs
idi
Tags6xR and HisExpressionBacterialPromoterPgrac and PxylAAvailable SinceOct. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEMS1199
Plasmid#29100PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748).DepositorAvailable SinceNov. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV ArcLightCo (Q239)-T2A-nls-mCherry
Plasmid#85806PurposeGenetically encoded voltage sensor ArcLight- codon optimizedDepositorInsertArcLightCo-Q239
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2CT-His-MBP-Lbu_C2c2_R1048A_H1053A
Plasmid#83484PurposeBacterial expression of L. buccalis C2c2 CRISPR effector (HEPN nuclease 2 inactive mutant).DepositorInsertLbu_C2c2_R1048A_H1053A
UseCRISPRTagsHis6-MBPExpressionBacterialMutationR1048A, H1053AAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC1-CMV-DAAO-NES
Plasmid#141107PurposeExpresses DAAO with nuclear export signal in mammalian cellsDepositorInsertDAAO-NES
TagsNuclear export signalExpressionMammalianMutationdeleted DAAO amino acids 367-368PromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
LUC01 (L/Sec/P)
Plasmid#112144PurposeMammalian expression vector to test the effect of substituting selenocysteine for Cys on luciferase enzyme activityDepositorInsertLuciferase coding region with Cysteine 258 mutated to selenocysteine (U) and wild-type PHGPx SECIS in the 3' UTR (Gpx4 Photinus pyralis, Rat)
ExpressionMammalianMutationCysteine 258 mutated to selenocysteine (U)Available SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIYC04
Plasmid#64741PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgMYC
Plasmid#125770Purposeconstitutive expression of a guide RNA targeting human MYC (CRISPR positive control)DepositorInsertsgMYC (MYC Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLED.ENS
Plasmid#193016PurposeExcitatory neuron-specific reporter (hSyn promoter, Synrg exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shWRN1
Plasmid#125781Purposeconstitutive expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Puro-CLEC16A-EMP2
Plasmid#69468PurposeExpresses CLEC16A-EMP2 fusion geneDepositorAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-HIF2a dPA (P405A, P531A)
Plasmid#232954PurposeStably express a constitutively stable version of HIF2a (HIF2a dPA)DepositorAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ai167 (TIT2L-ChrimsonR-tdT-ICL-tTA2) targeting vector
Plasmid#114431PurposeTarget a Cre-dependent ChrimsonR-tdTomato cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertChrimsonR-tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-spCas9
Plasmid#231404PurposeExpresses spCas9 from hSyn promoterDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only