We narrowed to 20,304 results for: IRE
-
Plasmid#172743PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-10; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-10
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-42
Plasmid#172758PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-42; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-42
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FOXO3 6A
Plasmid#24382DepositorInsertFOXO3 (FOXO3 Human)
TagsFLAGExpressionMammalianMutationT179A, S399A, S413A, S555A, S588A, and S626AAvailable SinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHR- flag-Lag16-fibcon-iCAM1
Plasmid#205212PurposeThis vector encodes of the synCAM (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA
Plasmid#153530PurposeUsed as a donor vector for the targeted correction of a mutation in PIGA exon 6DepositorInsertPIGA (a 1,991-bp fragment from intron 5 and exon 6)
UseDonor plasmidTagsN/AMutationNo mutationPromoterNo promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBa.GFP-AP1/gamma1
Plasmid#218801PurposeMammalian expression of mouse Ap1 g1DepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK-Cas9-gate
Plasmid#113743PurposeGateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving aminoglycoside phosphotransferase for G418 selection in plants.DepositorInsertCas9
UseCRISPR; Gateway destination vectorPromoterZ. Mays ubiquitin promoter, 35S promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUWR-Cad-Venus
Plasmid#58328PurposeDestination vector for inserting ubi-Cad-Venus to Drosophila melanogaster genomeDepositorInsertCad-Venus
ExpressionInsectPromoterpoly-ubiquitinAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-41
Plasmid#172757PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-41; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-41
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD24-rnc-sfGFP
Plasmid#51560PurposeGene encoding E. coli RNaseIII cloned as a N terminal translational fussion with superfolder GFP. Expression driven by arabinose (backbone is pBAD24).DepositorInsertrnc (rnc E. coli)
TagsGLESTCRHASLAVLADERRFSA and superfolder GFPExpressionBacterialMutationContains additonal aa at the end of the sfGFP in …Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCPP5951
Plasmid#128719PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopR1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CRY2-mCh-superPLDx30
Plasmid#188988PurposeA lentiviral plasmid encoding CRY2-mCh-superPLDx30 (an engineered PLD mutant with 30 times higher activity than the wild-type)DepositorInsertPLD
TagsCRY2 and mCherryExpressionMammalianMutationK109R, P245A, G328S, G381V, G429DAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNLuc
Plasmid#118058PurposeGBPart - NLuc Luciferase CDSDepositorInsertNano Luciferase
UseLuciferase and Synthetic Biology; GbpartAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
C1-MPAct(delta1-6)-mRuby3
Plasmid#155223PurposeF-actin bidning mutant of MPActDepositorInsertMutated version of F-tractin (aa 15-52 of rat ITPKA) fused to mRuby3 C-term tagged with the CaaX sequence derived from Kras4b
TagsmRuby3ExpressionMammalianMutationDeletion of first 6 AA from F-tractin (9-14 from …Available SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-6
Plasmid#172741PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-6; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-6
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
drebrin-His
Plasmid#40363DepositorAvailable SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRK5myc Rac1 wt
Plasmid#37030DepositorAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAGH42
Plasmid#107249PurposeVipp1-mGFPmut3 (or vipp1-gfp) construct with spectinomycin resistance cassette downstream used to replace the native copy of Vipp1 in Synechocystis (sll0617).DepositorInsertvipp1-gfp
UseSuicide vector for destined for double homologous…TagsmGFPmut3ExpressionBacterialPromoternative promoter of sll0617Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only