We narrowed to 12,154 results for: NSI
-
Plasmid#172907PurposeAAV-mediated expression of voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequenceDepositorHas ServiceAAV1InsertVoltron2-ST
UseAAV and Cre/LoxTagssoma localization targeting sequenceExpressionMammalianMutationA122DPromoterhSynapsin1Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLXI_TRC403 SMARCB1 var 2
Plasmid#111185PurposeInducible vector (V5 tagged) with SMARCB1 variant 2DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLXI_TRC401 SMARCB1 var 2
Plasmid#111182PurposeInducible vector (untagged) with SMARCB1 variant 2DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-Q306A
Plasmid#177334Purposebacterial expression of active SARS-CoV-2 3C-like proteinaseDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-hCdt1(1-100)ΔCy-mCherry-P2A-mVenus-hGeminin(1-110)-IRES-Blast
Plasmid#193139PurposeExpresses bicistronic P2A construct of C-CRL4Cdt2 reporter(hCdt1(1-100)ΔCy-mCherry-) and APC/C reporter (hGeminin(1-110)) with blasticidin resistanceDepositorUseLentiviralMutationhuman Cdt1 amino acids 1-100 w/ ΔCy mutation (aa6…PromoterEF1aAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDmelOR-mRho.V5.mER.hOr47a
Plasmid#126478PurposeHuman codon-optimized D. melanogaster Orco (hOrco) and Or47a (hOr47a). Or47a has N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved trafficking in mammalian cellsDepositorTagsH. sapiens HCN1 106VNKFSL111 (mER), H. sapiens Rh…ExpressionMammalianMutationcodon optimization for H. sapiens and codon optim…PromoterCMVAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (plus strand)
Plasmid#91850PurposeLuciferase reporter for IL2RA enhancer (IGI-P0345)DepositorInsertIL2RA CaRE4 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 scramble (plus strand)
Plasmid#91852PurposeLuciferase reporter for IL2RA enhancer (IGI-P0347)DepositorInsertIL2RA CaRE4 scramble (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationSequence scrambled from ch10:6094588-6094934Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28 E2 LBD-Tev-E1a-His
Plasmid#232117PurposeFor bacterial expression of a fusion protein containing from N to C-terminus: the lipoyl-binding domain of Human E2, a TEV protease site, a peptide from Human E1a, and a His tag.DepositorInsertDBT (DBT Human)
Tags6xHis, RIGHHSTSDDSSAY (AA331 to 345 (preprocessin…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 (minus strand)
Plasmid#91849PurposeLuciferase reporter for IL2RA enhancer (IGI-P0626)DepositorInsertIL2RA CaRE4 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE1 (plus strand)
Plasmid#91837PurposeLuciferase reporter for IL2RA enhancer (IGI-P0614)DepositorInsertIL2RA CaRE1 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR SMARCB1 var 2
Plasmid#111181PurposeSMARCB1 variant 2 in pDONR223 backboneDepositorInsertBAF47 (SMARCB1 Human)
ExpressionBacterialAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 PSMB5 guide 1
Plasmid#117073Purposesingle guide RNA targeting PSMB5; guide 1DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (plus strand)
Plasmid#91841PurposeLuciferase reporter for IL2RA enhancer (IGI-P0618)DepositorInsertIL2RA CaRE5 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE3 (minus strand)
Plasmid#91835PurposeLuciferase reporter for IL2RA enhancer (IGI-P0612)DepositorInsertIL2RA CaRE3 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893324 A>G, rs7090530 G>T, rs7090512 A&g…Available SinceJune 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE4 SNP (plus strand)
Plasmid#91851PurposeLuciferase reporter for IL2RA enhancer (IGI-P0346)DepositorInsertIL2RA CaRE4 SNP (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs61839660 C>TAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE5 (minus strand)
Plasmid#91836PurposeLuciferase reporter for IL2RA enhancer (IGI-P0613)DepositorInsertIL2RA CaRE5 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 PSMB5 guide 2
Plasmid#117074Purposesingle guide RNA targeting PSMB5; guide 2DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE2 (minus strand)
Plasmid#91847PurposeLuciferase reporter for IL2RA enhancer (IGI-P0624)DepositorInsertIL2RA CaRE2 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs6602425 A>C, G>A mutation at chr10:611706…Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only