We narrowed to 24,531 results for: CRISPR
-
-
pCAT007
Plasmid#171634PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting TRAC and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-TRAC
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
STAgR_Neo
Plasmid#102992PurposeCan be used as backbone for a STAgR reactionDepositorTypeEmpty backboneUseCRISPR; Pcr template for stagr vectorsPromoterU6Available SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pspCas9-Klenow-ST2-com-vector
Plasmid#176235PurposeVector plasmid for expressing spCas9-Klenow fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-Klenow to enhance expression.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-D156R
Plasmid#213744PurposeFor circular RNA-mediated prime editor using LbCas12a-D156R in HEK293T cellsDepositorInsertLbCas12a
UseCRISPRTagsBPNLSExpressionMammalianMutationD156RPromoterCMVAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCH68 (dAsCas12a-3xKRAB piggyBac)
Plasmid#217334PurposepiggyBac expression of dAsCas12a-3xKRABDepositorInsertdAsCas12a
UseCRISPRTagsnucleoNLS-3xKRAB-3xHA-P2A-TagBFP2ExpressionMammalianMutationE993APromoterCAGAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcU6_1 sgRNA
Plasmid#92395PurposeChicken-specific U6 sgRNA expression mini-vector, harbouring chick U6_1 pol III promoter.DepositorInsertchick U6.1 promoter and gRNA cloning cassette
UseCRISPRExpressionMammalianPromoterchick U6.1Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PXN
Plasmid#227315PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_C
Plasmid#72622PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRB14
Plasmid#52522Purposeexpresses a myc-tagged version of hCas9 in DrosophilaDepositorInsertS. pyogenes cas9 with humanized codon bias
TagsmycExpressionInsectPromotertubulinAvailable SinceApril 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only