We narrowed to 14,414 results for: cas9
-
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
UAS-u(XS)Cas9
Plasmid#127382PurposeExpresses Cas9 at very high levelDepositorInsertuORF-Cas9
UseCRISPRExpressionInsectAvailabilityAcademic Institutions and Nonprofits only -
UAS-u(L)Cas9
Plasmid#127385PurposeExpresses Cas9 at low levelDepositorInsertuORF(L)-Cas9
UseCRISPRExpressionInsectAvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-VPR
Plasmid#63800PurposeSP-dCas9-VPR with doxycycline-inducible expressionDepositorInsertdCas9-VPR
UseCRISPR and Synthetic Biology; PiggybacTagsVPR (VP64-p65-Rta)ExpressionMammalianPromoterTREAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-iCas9-neo
Plasmid#85400PurposeLentiviral vector encoding a doxycycline inducible EGFP reporter downstream of FLAG-tagged spCas9, separated by a P2A self-cleavage sequenceDepositorInsertFlag-iCas9-P2A-GFP
UseLentiviralTagsFlag-iCas9-P2A-GFPAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
Fuw-dCas9-Dnmt3a
Plasmid#84476PurposeLentiviral construct to express dCas9 fused with Dnmt3aDepositorAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-BsaIx2-DD-Cas9
Plasmid#75380PurposeExpresses DD-SpCas9 in mammalian cells and has a cloning site for an sgRNA. The FKBP12 L106P destabilization domain allows for inducible stabilization of Cas9 through the addition of Shield-1DepositorInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_NPM1_G6
Plasmid#178091PurposeExpresses the NPM1 G6 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with NPM1_mNeonGreen_Donor to tag NPM1 with mNeonGreen. pX330-like plasmid.DepositorInsertNPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9.mCherry
Plasmid#208342PurposeLentivirus with EF1a driven Cas9 linked (P2A) to mCherry.DepositorArticleInsertsCas9
mCherry
UseCRISPR and LentiviralTagsnuclear localization sequence (NLS) and FLAG tagPromoterEF-1aAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti‐Cas9‐2A‐Blast
Plasmid#73310PurposeLentiviral vector expressing human codon-optimized S. pyogenes FLAG-tagged Cas9 and blasticidin resistance from EFS promoterDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-sadCas9-VP64
Plasmid#115790PurposeAn AAV vector expressing S. aureus dCas9 fused to VP64.DepositorInsertSa-dCas9
UseAAVTagsNLS and NLS-VP64ExpressionMammalianPromoterCMVAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-Frame +0
Plasmid#66939PurposeCRISPaint frame selector +0DepositorInsertgRNA frame +0
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only