We narrowed to 9,003 results for: sgRNA
-
Plasmid#159827PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertsgRNA mosTI hygroR
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgRNA
Plasmid#124845PurposeVector for FLP-dependent expression of SaCas9 with gRNADepositorInsertSauCas9 gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato-TSC2-sgRNA
Plasmid#196195PurposeEditing human TSC2 locusDepositorInsertTSC2 (TSC2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-tRNApromo-sgRNA-espCas91_1
Plasmid#167210PurposePlasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMD19-PBBa_J23117-sgRNA-Spr
Plasmid#190793PurposeTemplate vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.DepositorInsertsgRNA (dummy)
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
v1em-Nterm-PE2max-U6-sgRNA
Plasmid#198732PurposeAAV genome encoding N-terminal PE2max and U6 expression cassetteDepositorInsertNterm PE2max-NpuN
UseAAVPromoterEFSAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgRNA-CLTA-mCherry
Plasmid#240637PurposeVector for expressing an sgRNA targeting CLTA promoter from the mouse U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoter.DepositorInsertpuro-T2A-mCherry
UseCRISPRExpressionMammalianAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9/VRQR-sgRNA (BbsI)
Plasmid#129725PurposeExpressing SpCas9/VRQR mutant and sgRNA for target sequence with NGA PAMDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNTI661 pRPR1(TetO)-sgRNA
Plasmid#139475PurposeVector for tet-regulated sgRNA expression in yeastDepositorInsertsingle guide RNA scaffold
UseCRISPRExpressionYeastPromoterpRPR1(TetO)Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-GST-EGFP-GPIDAF
Plasmid#213719PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIDAF under a CMV promoter.DepositorInsertEGFP
UseCRISPRTagsGSTPromoterCMVAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPUR-mU6-sgRNA-2XPP7
Plasmid#194504PurposeEmpty backbone for sgRNA-2XPP7 in CRIPSR FISHer systemDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-sp-sgRNA-RNF2_+41nick
Plasmid#135958PurposeS. pyogenes sgRNA for +41 nick in RNF2DepositorInsertRNF2_+41 nicking sgRNA
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK4/GCN2_sgRNA
Plasmid#218528PurposesgRNA targeting human EIF2AK4/GCN2DepositorInsertEIF2AK4 (EIF2AK4 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Puro
Plasmid#62207PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9 (3rd generation lentiviral vector)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only