We narrowed to 41,361 results for: Eras
-
Plasmid#115183PurposeLentiviral transduction and expression of PARK7V51G into any mammalian cellDepositorInsertPARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.V51GPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7C53A-VA
Plasmid#115184PurposeLentiviral transduction and expression of PARK7C53A into any mammalian cellDepositorInsertPARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.C53APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7H126A-VA
Plasmid#115185PurposeLentiviral transduction and expression of PARK7H126A into any mammalian cellDepositorInsertPARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.H126APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7E163K-VA
Plasmid#115186PurposeLentiviral transduction and expression of PARK7E163K into any mammalian cellDepositorInsertPARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.E163KPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-42Q-P90C
Plasmid#114606PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P90C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceOct. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-P80C
Plasmid#114602PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P80C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-A60C
Plasmid#114601PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & A60C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, A…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-42Q-P70C
Plasmid#114605PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P70C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-42Q-A60C
Plasmid#114604PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & A60C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, A…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-P90C
Plasmid#114603PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P90C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTHC_PGKneoLox2DTA.2
Plasmid#112624PurposeH2BmTeal_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsmTeal (mTFP1)PromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_MRN1
Plasmid#103858PurposeHeterologous, cobalt-inducible expression of SQE1 and MRN1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertmarneral synthase 1 (MRN1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mEPAS1
Plasmid#60793PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains EPAS1 3' UTR and mutated miR-155 sitesDepositorInsertEPAS1 3'UTR and mutated miR-155 binding site (EPAS1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_26
Plasmid#60306PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_34
Plasmid#60313PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_12
Plasmid#60319PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS C18orf26)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_14
Plasmid#60321PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS CCRN4L)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_8
Plasmid#60286PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_11
Plasmid#60288PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only