We narrowed to 18,351 results for: multi
-
Plasmid#203173PurposeExpression of human cis-prenyltransferase complex for purificationDepositorTagsStrep-Tag II-TEV and internally 6HIS taggedExpressionMammalianPromoterCMVAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only
-
LPUtopia-7
Plasmid#199212PurposeLanding Pad Utopia_v7 donor plasmid for AAVS1 site-specific integration in human cells. Use NeoR and eGFP as positive selection marker for AAVS1-targeted insertion and RFP as negative selection markerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsaminoglycoside phosphotransferase,
enhanced Green Fluorescence Protein
Red Fluorescence Protein
ExpressionMammalianPromoterCMV and thymidine kinase promoterAvailable sinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK)-12xHRE
Plasmid#172334Purposehypoxic responsive reporterDepositorPublicationInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterPGKAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(EF1a)-TTN
Plasmid#172327PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato 2a HSVtk 2a Neo followed by an EF1a promoter driving nuclear d2eGFP E2A HygromycinDepositorPublicationInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterEF1-alphaAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDest-1.7kbfabp6-eGFP-pA-CrymCherry
Plasmid#159088PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA insertsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsUseFluorescent reporterPromoter1.7kb fabp6Available sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA
Plasmid#136652PurposeExpresses St1BE4max-LMD9 in mammalian cells along with its U6-driven sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-BAP-Sox2
Plasmid#133281PurposeExpression of target proteins BAP-Sox2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSox2 (SOX2 Human)
TagsBiotin Acceptor Peptide contains 7-His-tagExpressionMammalianPromoterCMVAvailable sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMJA285= pSin-TCRab-CMVp-Puro
Plasmid#116875Purposestable TCR expression in human T cellsDepositorUseLentiviralExpressionMammalianMutationdeletion of EF1-a promotorPromoterCMV PromotorAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Trex2-bpA-EF1BFP
Plasmid#111144PurposeExpression of mouse Trex2 and BFP reporter in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAExpressionMammalianPromoterCAG and EF1Available sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP-H2B-C1
Plasmid#108411PurposeHistone 2B fused to monomeric near-infrared fluorescent protein miRFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmiRFP-H2B (H2BC21 Human)
TagsmiRFPExpressionMammalianPromoterCMVAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3327
Plasmid#107535PurposeExpresses As crRNA and human codon optimized AsCpf1(RVR mutant) in mammalian cells.DepositorInsertsAs crRNA
hAsCpf1(RVR mutant)
Tags3xHA, NLS, and SV40 NLSExpressionMammalianMutationS542R, K548V, N552RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES-mCE NLS
Plasmid#82466PurposeExpresses cytoplasmic restricted form of myc tagged mRNA capping enzymeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNES mRNA capping enzyme (Rngtt HIV, Mouse)
TagsMycExpressionMammalianAvailable sinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A
Plasmid#69792PurposePebble isoform A in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble - Drosophila guanine nucleotide exchange factor
UseP element-based puast vector for gal4-regulated e…TagsHA tagExpressionInsectMutationEncodes Pbl (NP_729306.1) lacking last 9 amino ac…Promoterhsp70 promoterAvailable sinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1Xpress-AbrGAP
Plasmid#38177DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAbr GAP domain (ABR Human)
TagsXpressExpressionMammalianMutationABR GAP domain including amino acids 597-859Available sinceSept. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-CaMKKbeta S129A, S133A, S137A
Plasmid#32454DepositorInsertCalcium/Calmodulin dependent protein kinase kinase beta (Camkk2 Mouse)
TagsFLAG and GFPExpressionMammalianMutationS129A, S133A, S137APromoterCMVAvailable sinceApril 23, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSG5-FLAG-CaMKKbeta rat S129D, S133D, S137D
Plasmid#32457DepositorInsertCalcium/Calmodulin dependent protein kinase kinase beta (Camkk2 Rat)
TagsFLAGExpressionMammalianMutationS129D, S133D, S137D (S3V, G96R, and P108L also pr…PromoterSV40Available sinceApril 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1Xpress-Abr-HisC
Plasmid#32509DepositorAvailable sinceFeb. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pB-EF1a-FastFUCCI-IRES-3xnls-mTagBFP2 (JDW 1511)
Plasmid#242599PurposeA PiggyBac expression vector containing the human EF1a promoter driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110) (EEF1A1 Human)
ExpressionMammalianPromoterhuman EF1aAvailable sinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only