172,845 results
-
Plasmid#189564PurposeCaHygB hygromycin resistance gene in the pSFS2A flipper backbone for genetic manipulation of Candida albicansDepositorInsertHygB
ExpressionYeastAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-p18-HA
Plasmid#42338DepositorAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shETV5-B
Plasmid#74978PurposeshETV5 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-RapGAP
Plasmid#118324PurposeExpression of RapGAPDepositorInsertRapGAP
TagsFlagExpressionMammalianPromoterCMVAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
TFORF2120
Plasmid#143871PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3_SEPT6
Plasmid#71583Purposemammalian expression of human SEPT6 with a GFP fusionDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV IRES Luciferase
Plasmid#18760DepositorTypeEmpty backboneUseLuciferase and RetroviralExpressionMammalianAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.5 shETV5-A
Plasmid#74977PurposeshETV5 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF0915
Plasmid#143451PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
RP4-6
Plasmid#80385PurposeHelper plasmid for mobilisation derived from RP4. Spectinomycin/Streptomycin resistantDepositorInsertSpectinomycin/Streptomycin
UseHelper bhr plasmid for mobilizing other plasmids …TagsnonePromoterNoneAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC57-TPNOX
Plasmid#87853PurposeThis plasmid contains human codon optimized sequence of Lactobacillus brevis mutant of a water-forming oxidase that can be used to increase NADP+/NADPH ratio in mammalian cells.DepositorInsertTPNOX
TagsC-terminal FLAG tag with a linkerExpressionBacterialAvailable SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
mTagBFP2-Integrin-Beta1-N-18
Plasmid#55303PurposeLocalization: Integrin/Focal Adhesions, Excitation: 399, Emission: 456DepositorAvailable SinceOct. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
hGli2 flag3x
Plasmid#84920Purposemammalian expression of Gli2DepositorAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134B2.0
Plasmid#167158PurposeGolden Gate entry vector to express the 4th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV mClover3-Galectin-3
Plasmid#215376PurposeExpression of the endolysosomal damage marker Galectin-3 with an N-terminal mClover3 tag.DepositorInsertLGALS3 (LGALS3 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (AAV Retrograde)
Viral Prep#51084-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (#51084). In addition to the viral particles, you will also receive purified AAV-hSyn1-GCaMP6s-P2A-nls-dTomato plasmid DNA. GCaMP6s calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under a human synapsin1 promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsnuclear dTomato (physically separate, not a fusion protein)Available SinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only