We narrowed to 17,356 results for: sequence
-
Plasmid#109158PurposeEncodes human full-length HDAC1 to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length HDAC1, sequence-optimized for insect cells (HDAC1 Human)
ExpressionInsectPromoterp10Available SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
GANLS
Plasmid#50852PurposeExpresses one ddFP in mammalian cells, the second plasmid for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with plasmid NESRA-DEVD-BNLS.DepositorInsertddGFP A
Tagstriplicated NLS sequence DPKKKRKVExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
Plxna2-Fc-His
Plasmid#72123PurposeExpresses the extracellular region of the PlexinA2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
RANLS
Plasmid#50843PurposeExpresses one ddFP in mammalian cells, the second plasmid for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with plasmid GANES-DEVD-BNLS.DepositorInsertddRFP A
Tagstriplicated NLS sequence DPKKKRKVExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSPORT1[attB/Ins1/NbT promoter/glGFP/bglobin 3'-UTR/Ins2]
Plasmid#74102Purposeplasmid driven under neuronal beta-tubulin promoter, bearing attB and two insulator sequences (opposite directions pointing inward towards the reporter gene)DepositorInsertsXenopus laevis beta-tubulin gene promoter region and 5'UTR
Green Lantern Green Fluorescent Protein
Rabbit beta 1-globin gene 3'UTR
ExpressionBacterialAvailable SinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-CXCR4
Plasmid#98947PurposeMammalian expression plasmid for N-terminal FLAG-tagged human CXCR4DepositorInsertCXCR4 (CXCR4 Human)
TagsFLAG (dykdddd) epitope tag and Signal/leader sequ…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC74
Plasmid#62342PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-cytoBirA-2A-mCherry_Ras
Plasmid#80062PurposeSox10 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
BmR1_04g07470-bio-His
Plasmid#108037PurposeExpresses enzymatically monobiotinylated full-length BmR1_04g07470 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBmR1_04g07470
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HLA-cMyc-EcopT1R1
Plasmid#113962Purposemammalian expression plasmid for c-myc-tagged E. coli codon-optimized human T1R1 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R1 (TAS1R1 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationtruncate N-terminal 24 residuesAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hSOX10
Plasmid#24749DepositorInsert(sex determining region Y)-box 10 (SOX10 Human)
UseGateway donor vectorMutationwildtype sequenceAvailable SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-mTQ2
Plasmid#110196PurposeEncodes for human CXCR4 coding sequence tagged with the mTQ2 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 FS1
Plasmid#113955Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, one base pair dele…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-LSSmOrange
Plasmid#110197PurposeEncodes for human CXCR4 coding sequence tagged with the LSS-mOrange FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3 basic Mut E2
Plasmid#48748PurposeExpression of luciferase driven by mPer2 promoter fragment containing mutated E-box2 (bases -112 to +98 with respect to transcription start site at +1)DepositorInsertmPer2 promoter/enhancer region containing mutated E-box2 (-112 to +98)
UseLuciferaseMutationMutated E-box2 sequence from CACGTT to GCTAGTAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-Tlr4
Plasmid#27148DepositorInserttoll-like receptor 4 (Tlr4 Mouse)
Tags3x FLAGExpressionMammalianMutationNative signal peptide sequence (original amino ac…Available SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
A3Ai-Cas9n-UGI-NLS
Plasmid#109425PurposeExpresses human APOBEC3A containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only