We narrowed to 249,250 results for: Gene
-
Plasmid#25769DepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 3, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pIB164
Plasmid#90187PurposeE. coli - Streptococci shuttle plasmid for gene expression in streptococci with Pami promoterDepositorTypeEmpty backboneTagsNoneExpressionBacterialAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cre-P2A-dTomato
Plasmid#107738PurposeCan be used to express Cre recombinase and simultaneously the red fluorescent protein dTomato. Can also be used to create adeno-associated virus for delivery of these genes.DepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertCre, dTomato
UseAAV and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN
Plasmid#11160PurposeMammalian expression vector for cloning and expressing your gene under the CAG promoterDepositorHas ServiceCloning Grade DNAInsertmodified multiple cloning sites
ExpressionMammalianAvailable SinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-SNAP-KanMX6
Plasmid#87024PurposeTag S. pombe genes in C terminal with SNAPDepositorInsertSNAP
ExpressionBacterial and YeastAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg
Plasmid#60508PurposeSB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of rtTA and hygromycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterTCE & RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-1
Plasmid#21714DepositorInsertROSA26 (Gt(ROSA)26Sor Mouse)
UseMouse TargetingAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pJL-TRBO
Plasmid#80082PurposeAn improved agroinfection-compatible Tobacco mosaic virus (TMV)-based transient expression vector that lacks the TMV CP gene coding sequence.DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA
Plasmid#20298PurposeCre-activated AAV expression of humanized ChR2 with H134R mutation fused to EYFP for optogenetic activationDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV5, and AAV9Insertchannelrhodopsin-2
UseAAVTagsEYFPExpressionMammalianMutationhumanized ChR2 gene with histidine 134 changed to…PromoterEF1alphaAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla
Plasmid#60510PurposeSB-transposon with inducible SfiI cloning site for GOI (contains firefly luciferase) and constitutive expression of rtTA and blasticidin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterTCE & RPBSAAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA
Plasmid#20297PurposeCre-activated AAV expression of humanized ChR2 with H134R mutation fused to mCherry for optogenetic activationDepositorHas ServiceAAV Retrograde, AAV1, AAV5, AAV8, and AAV9Insertchannelrhodopsin-2
UseAAVTagsmCherryExpressionMammalianMutationhumanized ChR2 gene with histidine 134 changed to…PromoterEF1alphaAvailable SinceJune 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pJet1.2 sfGFP
Plasmid#117123PurposeC-terminal GFP tagDepositorInsertSuperfolder GFP
UseGolden gate donor vector for gene targeting in ba…TagssfGFPAvailable SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIB184 (EM)
Plasmid#90194PurposeE. coli - Streptococci shuttle plasmid for gene expression in streptococci with P23 promoterDepositorTypeEmpty backboneTagsNoneExpressionBacterialAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZ8-Ptac
Plasmid#74064PurposeIPTG inducible version of pZ8-1 plasmid, to which lacIq was added, KanRDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterptacAvailable SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRPR1_gRNA_handle_RPR1t
Plasmid#49014PurposegRNA expression empty vector (yeast)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastPromoterpRPR1Available SinceOct. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPR219.05
Plasmid#78554PurposePlasmid expressing UirR, response regulator and PcsiR1-regulated GFP outputDepositorInsertuirR
UseSynthetic BiologyPromoterJ23115Available SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIB185
Plasmid#90196PurposeE. coli - Streptococci shuttle plasmid for gene expression in streptococci with Pveg promoterDepositorTypeEmpty backboneTagsNoneExpressionBacterialAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBADZ-HisCre
Plasmid#111187PurposeHelper plasmid containing Cre-recombinase gene, which is expressed in DH10MultiBac cellsDepositorInsertCre recombinase
TagsHis tagExpressionBacterialAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only