We narrowed to 4,533 results for: Gaa
-
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_3
Plasmid#155067PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA3
Plasmid#232625PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode2
Plasmid#229063PurposeExpression mappingDepositorInsertCAG Barcode2
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-flag-YTHDF2-N
Plasmid#52302PurposeFlag-tagged YTHDF2 N-terminal domain, made by mutating to E384(GAA) to stop codon(TAA)DepositorInsertYTHDF2 (YTHDF2 Human)
TagsflagExpressionMammalianMutationChanged E384 to stop codonPromoterT7Available SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
Creb5 shRNA
Plasmid#195020PurposeBovine Creb5 shRNA targeting the Creb5 3′UTRDepositorInsertCreb5 shRNA (CREB5 Bovine)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-WIPI2B H85E K88E I92E
Plasmid#175033PurposeExpresses WIPI2B (H85E K88E I92E) fused to Halo in mammalian cells to abrogate interaction with ATG16L1DepositorInsertWIPI2B (H85E K88E I92E) (WIPI2 Human)
TagsHaloTagExpressionMammalianMutationHistadine 85 to Glutamate (CAC to GAG); Lysine 88…PromoterCMVAvailable SinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
EMX1_sgRNA
Plasmid#100555PurposeExpresses EMX1 sgRNA. Target sequence: GAGTCCGAGCAGAAGAAGAADepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT055b
Plasmid#96877Purposetheophylline-agRNA-FANCFDepositorInserttheophylline-agRNA-FANCF
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT057a
Plasmid#96872PurposeHHR-bsgRNA-EMX1DepositorInsertHHR-bsgRNA-EMX1
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050Z4 (yellow)
Plasmid#132425Purposeexpress arrays of gRNA targeting Yellow under dU6-3 promoterDepositorInsertyellow gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
EMX1*_sgRNA
Plasmid#100558PurposeExpresses EMX1* sgRNA. Target sequence: (G)GAGTCCGAGCAGAAGAAGAA. Same target sequence as #100555, except with an additional 5' G.DepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (CTNNB1)
Plasmid#180193PurposeAAV vector carrying a guide RNA targeting the human CTNNB1 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7529 pHR (hU6-crLPT-EFS-PuroR-WPRE)
Plasmid#214877PurposeLentiviral vector encoding RfxCas13d targeting LPT guide arrayDepositorInserthU6-crLPT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA1
Plasmid#232623PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA2
Plasmid#232624PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMN-MEF2C
Plasmid#232627PurposeLentiviral plasmid expressing mouse MEF2C.DepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMN-SRF
Plasmid#232629PurposeLentiviral plasmid expressing human SRF.DepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMN-MEF2A
Plasmid#232626PurposeLentiviral plasmid expressing human MEF2A.DepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMN-MEF2D
Plasmid#232628PurposeLentiviral plasmid expressing mouse MEF2D.DepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only