We narrowed to 11,940 results for: 110
-
Plasmid#240025PurposeHuman eIF3b for further cloning or expression in insect cells for purificationDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only
-
hPSD-95_PDZ3
Plasmid#245905PurposeBacterial expression of PSD-95 PDZ3 domain (302-402)DepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hPSD-95_PDZ2
Plasmid#245904PurposeBacterial expression of PSD-95 PDZ2 domain (155-249)DepositorAvailable SinceOct. 23, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDonr 201_MGA
Plasmid#240327PurposeEntry vector for Gateway with MGADepositorInsertMGA (MGA Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_FOidr_177
Plasmid#244729PurposeExpress mEGFP-tagged intrinsically disordered protein (IDR), FOidr_177, derived from human fusion protein SLC16A14_SP110DepositorInsertFOidr_177
Tagsmonomeric EGFPExpressionMammalianMutationUnmutatedAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆11cag
Plasmid#245370PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆11cag (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus 3 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆7cg
Plasmid#245371PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆7cg (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation7-bp deletion, H96Vfs*29, plus 2 synonymous mutat…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Nsp3(1-111)
Plasmid#242947PurposeGFP and the Ubl1 domain of the SARS-CoV-2 Nsp3 protein (aa 1-111)DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_HA-spGFP11
Plasmid#240224PurposeGateway entry clone for cloning in insert sequences by gibson assembly to create a C-terminal HA-spGFP11 tag. No ATG start codon.DepositorTypeEmpty backboneUseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G42080-mKOk
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G33650-mKOk
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3N
Plasmid#234614PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_3DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4N
Plasmid#234611PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_4DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250N, D262NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4V
Plasmid#234610PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to valineDepositorInserthnRNPA1_LCD_4DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250V, D262VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only