We narrowed to 13,850 results for: sequence
-
Plasmid#72012PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pCS2-hFAM 3B-His
Plasmid#172192PurposeCoding sequence of human FAM3B pCS2 C terminal 6xHis tag used for protein purification from conditioned mediumDepositorInserthFAM 3B
TagsHisExpressionMammalianAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #1
Plasmid#136581PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTB2-Avi-Cerulean-Rpl10a
Plasmid#79880PurposeBeta-actin2 promoter driving Avi-tagged protein containing Cerulean protein fused to zebrafish Rpl10a ribosomal unit (Tryon et al. 2012); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to zebrafish Rpl10a ribosomal unit (rpl10a Zebrafish)
TagsAviExpressionBacterialPromoterBeta-actin2Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sema3b(L)-AP-His
Plasmid#72013PurposeExpresses the Sema3B protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKCAG-H2BmCherry-OptoJNKi
Plasmid#89741PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to chromatin with H2B, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseOptogeneticsTagsHistone2B and mCherryExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-LN
Plasmid#188231PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorUseRetroviralExpressionMammalianAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-GAP-LacI-Mit1AD
Plasmid#126722PurposeLacI-Mit1AD on pGAPZ_ A expression vectorDepositorInserthybrid lacI-Mit1 activation domain coding sequence
ExpressionYeastPromoterGAPAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1273
Plasmid#119265PurposeE. coli attTn7 site with B. subtilis flanking sequence cloned into pACYCDepositorInsertE. coli attTn7
ExpressionBacterialAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Islr-AP-His
Plasmid#71950PurposeExpresses the entire Islr protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-NLS-BirA-2A-mCherry_Ras
Plasmid#80065PurposeZic2a promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCGN-HCF-1-N450
Plasmid#92321PurposeN-term 1-450 of HCF-1 proteinDepositorInsertHCF-1 (HCFC1 Human)
TagsHAExpressionMammalianMutationAA 2-450. Note that a SRRASGTYGRV amino-terminal …PromoterCMVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ntng2.a-Fc-His
Plasmid#72120PurposeExpresses the extracellular region of the Netrin G2, isoform a protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.b-Fc-His
Plasmid#72111PurposeExpresses the extracellular region of the Netrin G1, isoform b protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-Drosha (NLS-P426)
Plasmid#171538PurposeEncodes mutant human Drosha proteinDepositorInsertDROSHA (DROSHA Human)
ExpressionMammalianMutationan SV40 NLS sequence (PKKKRKVGI) insertion into t…Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINT2
Plasmid#127529PurposePlasmid encodes A. thaliana codon optimized Integrase 2.DepositorInsertIntegrase 2 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pAct-AtINT5
Plasmid#127531PurposePlasmid encodes A. thaliana codon optimized Integrase 5.DepositorInsertIntegrase 5 coding sequence codon optimized for A. thaliana expression.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only