We narrowed to 18,014 results for: Por
-
Plasmid#35243DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1486
Plasmid#29237PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle16 (C8orf46 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti CMV Hygro DHFR.dn-cHSF1
Plasmid#134731PurposeLentiviral expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.dn-cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCold I-Ub-mH1-Ncys (M1-C-T2)
Plasmid#253410PurposeExpression in E. coli of a mouse H1 variant fused with His-tagged monoUb at N-terminus. An additional Cys was inserted between M1 and T2 in H1.DepositorAvailabilityAcademic Institutions and Nonprofits only -
pCold I-Ub4-mH1-Ncys (M1-C-T2)
Plasmid#253411PurposeExpression in E. coli of a mouse H1 variant fused with His-tagged linear-tetraUb at N-terminus. An additional Cys was inserted between M1 and T2 in H1.DepositorAvailabilityAcademic Institutions and Nonprofits only -
pMIH-TFAM-GFP
Plasmid#113704PurposeFluorescent fusion protein used to visualise mitochondrial nucleoids, with hygromycin selectionDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
OMM-short-RspA-CFAST
Plasmid#233594PurposeExpression of RspA-CFAST on the outer mitochondrial membraneDepositorInsertTOM70 fragment-RspA-CFAST (TOMM70 RspA-CFAST from Rheinheimera sp A13L and TOM70 fragment from Homo sapiens, Human)
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-mEmerald-CAPRIN1
Plasmid#164218PurposeExpresses mEmerald tagged CAPRIN1 under EF-1a promoterDepositorAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLCO1B3_STOP
Plasmid#161366PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLCO1B3 (SLCO1B3 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-NB
Plasmid#197092PurposePiggyBac plasmid with tet-inducible expression of transcription factors for sensory neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_SIV-(SalI)-syn-IRES-mEmerald-CaV1.2 WPRE
Plasmid#236241PurposeLentiviral expression of voltage-gated calcium channel, CaV1.2, N-terminally tagged with mEmeraldDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A4_STOP
Plasmid#161148PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A4 (SLC25A4 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
EF1a-L274GMmMetRS-T2A-mCherry
Plasmid#220800PurposeLentivirus expressing mutant tRNA synthetase for incorporation of noncanonical amino acids in nascent proteins plus mCherry reporter and puro resistanceDepositorInsertMars1 (Mars1 Mouse)
UseLentiviralTags2xFLAG and T2A-mCherryMutationmutation in MetRS to change aa 274 from L to GPromoterEF1aAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB S. pyogenes Cas9, synthetic, Human)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-28a(+)-FGF2-K128N
Plasmid#120284PurposeProduce human recombinant FGF2 K128N in DE3 cellsDepositorInsertBasic fibroblast growth factor 2 (FGF2 Synthetic, Human)
Tags6x HisExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHDR-FOXL2-T2A-tdTomato-PuroTK
Plasmid#192892PurposeHDR donor for inserting FOXL2-T2A-tdTomato reporterDepositorInsertFOXL2-tdTomato (FOXL2 Human)
UseCRISPRMutationT2A-tdTomato fluorescent reporterPromoterPGKAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only